ID: 945134901

View in Genome Browser
Species Human (GRCh38)
Location 2:206616641-206616663
Sequence TCCAGCTGGCCCTCAGTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945134901 Original CRISPR TCCAGCTGGCCCTCAGTCGG TGG Intronic
900627138 1:3613530-3613552 TCCAGCCGGCCCTGGGACGGGGG + Intergenic
900660370 1:3779068-3779090 TCCAGCTGGCACTGAGTGTGTGG + Exonic
902383253 1:16062390-16062412 TCCTGCTGGCCCTGGGGCGGGGG - Intronic
902614983 1:17618784-17618806 TGGAGCTGGACCTCAGACGGAGG - Intronic
902798370 1:18814435-18814457 GCCAGCTGGCCCTCCCTAGGAGG - Intergenic
902805658 1:18859762-18859784 TCCAGGTGCCCCACAGTCGGTGG - Intronic
905201977 1:36321945-36321967 TCAAGCTGGGCCTCAGTCCTGGG + Intronic
909994925 1:82267640-82267662 TCCAGCTGTCCCACAGTCCCGGG + Intergenic
910565158 1:88635514-88635536 GCCAGCTGGTCCTCAGTCATAGG + Intergenic
914244378 1:145874832-145874854 TACAGCAGGCCCTGAGCCGGCGG - Exonic
916572347 1:166038825-166038847 TGCTGCAGGCCCTCAGTCTGTGG - Intergenic
920452473 1:206070194-206070216 ACCAGCTCGCCCTCAGTAGAAGG + Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924243427 1:242060708-242060730 ACCAGCTGGCCCTCTGTTGCTGG + Intergenic
1066306637 10:34150656-34150678 TCCAGCTGGGCCTCAGGCTTGGG + Intronic
1067070011 10:43124371-43124393 TCCAGCTGGCCACCAGCTGGGGG - Intronic
1067566759 10:47345141-47345163 TCCAGTTGGCCATCAGTGGTTGG - Intergenic
1069744273 10:70705203-70705225 TCAAGCTGGCCCTCACCCCGCGG + Intronic
1070574402 10:77666658-77666680 TCCAGGTGGCCCACACTGGGGGG + Intergenic
1071422573 10:85515395-85515417 TTCAGCTGGGACTCAGTCTGTGG - Intergenic
1073185492 10:101613068-101613090 TCTAGCTGGCCCCCAGCCCGGGG + Intronic
1074869760 10:117567412-117567434 TCCAGCTGGGGCTCAGCTGGGGG - Intergenic
1075337562 10:121619207-121619229 TCCTGCTGGCTGTCAGTCAGGGG + Intergenic
1076124843 10:127965927-127965949 TCCTCCTGGCCTTCAGTCTGAGG + Intronic
1078580966 11:12539331-12539353 TCCAGCTGGTCCCCTGTCTGAGG - Intergenic
1079096320 11:17512755-17512777 TCCAGCTAGCCCTCGGTAGAGGG - Intronic
1084164825 11:67370721-67370743 GCCAGCTGCCCCTCAGTCCCTGG + Intronic
1084733112 11:71087263-71087285 TCCAGCTGGCCCTGGGATGGAGG - Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1087590309 11:100178855-100178877 TCCAGCTGACCCCCAATGGGTGG + Intronic
1090317522 11:125807049-125807071 GCCTCCTGGCCCTCAGTCAGGGG - Intergenic
1091794109 12:3287573-3287595 TCCAGCTGGACCTTAGACAGAGG - Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1101973778 12:109337062-109337084 TCCAGCTGGAACACAGTCGTTGG + Intergenic
1102305869 12:111804098-111804120 TCCAGCAGGCCCTGAGTCCCCGG - Intronic
1103458865 12:121088223-121088245 TCCAGCTTGACCTCAGCTGGAGG - Intergenic
1108407626 13:50121615-50121637 TCCATCTGGCTCTCAGTCTTAGG + Intronic
1110574576 13:77040971-77040993 TACAGCTGCCCTGCAGTCGGAGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1121311689 14:92938779-92938801 AGCAGCTGGCACTCAGTTGGGGG + Exonic
1123492115 15:20789128-20789150 TCCAGCAGGCCCTCAGCAGATGG - Intergenic
1123548619 15:21358218-21358240 TCCAGCAGGCCCTCAGCAGATGG - Intergenic
1126110808 15:45173662-45173684 TCCAGCTGTCCCACAGGTGGAGG + Exonic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1130370831 15:83284410-83284432 GCCAGCTGGCCCTCGGGAGGTGG + Intronic
1131439380 15:92447526-92447548 TCCTGATGCCCCTCAGTCAGTGG - Intronic
1202956953 15_KI270727v1_random:85449-85471 TCCAGCAGGCCCTCAGCAGATGG - Intergenic
1132592848 16:733892-733914 TCCCGCTGGGCCTCAGGTGGGGG + Intronic
1133366346 16:5213324-5213346 TGCAACTGGCTCTCAGTAGGGGG + Intergenic
1136068803 16:27775985-27776007 ACCCGCTGGCCGTCAGTGGGTGG - Intronic
1141424190 16:83934820-83934842 GCCTGCTGGCCCTCAGTCCAGGG + Intronic
1142025060 16:87808134-87808156 TGCTGCTGGCCTCCAGTCGGTGG + Intergenic
1142125283 16:88407151-88407173 GCCAGCTGTCCCTGAGTGGGCGG + Intergenic
1143176635 17:4959403-4959425 ACCAGCTGTCCCTCAGGCTGGGG - Exonic
1145279259 17:21456101-21456123 TCCTGCTGGGCCTCAGTCTTTGG - Intergenic
1151854452 17:76710957-76710979 CCCAGCTGGCCCGCACTCGGCGG - Intronic
1152083728 17:78204925-78204947 TCCTGTTGGACCTCAGTGGGTGG + Intronic
1154367194 18:13721987-13722009 TCCAGCCTCCCCTCAGTCAGGGG + Intronic
1158406602 18:57165474-57165496 TCCAGCTGCCCCTGACTCTGGGG + Intergenic
1160900998 19:1428577-1428599 TCCTGCTGCCCCGCAGTGGGCGG + Intronic
1162379517 19:10323260-10323282 TCCTGCAGGCCCTCAATCGGGGG - Exonic
1163267158 19:16228224-16228246 ACCAGAAGGCCCTCAGTGGGTGG - Intronic
1164472723 19:28549629-28549651 TCTAGCTGGTCCTAGGTCGGGGG - Intergenic
1167286947 19:48603672-48603694 GCCAGCGGGCCGTCAGGCGGCGG + Exonic
925189922 2:1874620-1874642 TGCAGCAGGGCCTCAGACGGGGG - Intronic
926806623 2:16717206-16717228 TCCAGCTGGTCCACAGCCTGTGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929532746 2:42762896-42762918 TGCAGCTGGCCCTCAGCCCTGGG + Exonic
930766786 2:55092636-55092658 TCCTGCTTGCCCTCTGTCAGAGG + Intronic
931462509 2:62461334-62461356 TGCAGCTTGCCCTCAGCCGCAGG + Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943394958 2:187322586-187322608 TCTAGCTGGCCCTCACTCCATGG - Intergenic
944530118 2:200659402-200659424 CCCATCTTGCCCTCAGTCAGTGG + Intronic
945134901 2:206616641-206616663 TCCAGCTGGCCCTCAGTCGGTGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948206397 2:236164700-236164722 TCCCGGCAGCCCTCAGTCGGAGG - Intergenic
1171431826 20:25087765-25087787 TCCAGCTGTCCATCAGTCTGGGG + Intergenic
1173256362 20:41396486-41396508 TCCAGCTGGCTCTCAGAAGCAGG - Intergenic
1176390586 21:6161112-6161134 TCCAGATGGCCCCCAGGCCGTGG - Intergenic
1178334793 21:31733048-31733070 TCCAGCTGGTCCTCCTTCGGGGG - Intergenic
1179264234 21:39788536-39788558 TCCAGCAGGACCTCTGCCGGTGG - Intronic
1179732881 21:43377127-43377149 TCCAGATGGCCCCCAGGCCGTGG + Intergenic
1181546340 22:23604595-23604617 TCCAGCAGTCCCTCTGTCAGGGG - Intergenic
1182622076 22:31623816-31623838 CCCAGCTGGCCCTGAGGCGGAGG - Exonic
1183091586 22:35525841-35525863 CACAGCAGGCCCTCAGTCGCTGG - Intergenic
1183292933 22:37013954-37013976 TCCAGCTGGCCCAGTGTGGGAGG - Intronic
1183929586 22:41228336-41228358 TCCACCTGGCTCTCAGGCCGTGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
956386514 3:68725265-68725287 TCCAGCTGGCCAGCAGTGGCAGG - Intergenic
956408357 3:68952083-68952105 TTCACCCGGCCCTCAGTCTGTGG + Intergenic
958546473 3:95558759-95558781 TAAAGCTGTGCCTCAGTCGGTGG + Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961631374 3:128301502-128301524 TCTAACTGGCCCTCAGTAAGTGG + Intronic
962850005 3:139301301-139301323 TCCAGCTTGCCCTTACTCTGGGG + Intronic
965509887 3:169556573-169556595 TCCAGCTCACACTCAGTAGGAGG - Intronic
966355703 3:179076360-179076382 TACAGCTGTCCCTCAGTATGTGG - Intergenic
966837355 3:184059431-184059453 TCCAGGTGGCCATCAGGCGCAGG + Exonic
969605894 4:8202139-8202161 ACCACCTGGCCCTGAGTCTGTGG - Intronic
970302702 4:14698162-14698184 TCCAGCTGACCATCAGTAAGAGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988599531 5:32626788-32626810 TACAGCAGGTCCTCAGTCTGAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
995092096 5:108189841-108189863 TCTTGCTGGCCCTCAGCCAGTGG - Intronic
997120110 5:131164945-131164967 TCCAGCGGGCCCCCAGCCAGCGG - Intronic
1001028327 5:168243197-168243219 TTCAGCTAGCCCTGAGTGGGTGG - Intronic
1002005315 5:176228217-176228239 TCCTGATGGCCTTCAGTCAGTGG - Intergenic
1002221059 5:177682408-177682430 TCCTGATGGCCTTCAGTCAGTGG + Intergenic
1006583545 6:35090381-35090403 TCCAAGTGGGCCTCTGTCGGGGG + Exonic
1006846908 6:37068714-37068736 TGCAGCTGGCCCTCACTGAGTGG + Intergenic
1007192304 6:40029936-40029958 TCCAGCTGTCCCTCATTTGGTGG + Intergenic
1007807836 6:44463772-44463794 CGCAGCAGGCCTTCAGTCGGTGG + Intergenic
1023115993 7:36863072-36863094 TCCAGCTGTCCCTCATTGAGAGG + Intronic
1028715343 7:93959702-93959724 TCCAGCTGGCTGTCAATAGGAGG + Intergenic
1031689821 7:124773726-124773748 TCCAGCTGCCACTCAGTCCTTGG + Intergenic
1032481242 7:132248953-132248975 TCCAGCTGGGCCTCACTTGACGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1042614300 8:70631871-70631893 TTCAGCTTGCCCTCCGTGGGCGG + Intronic
1045910785 8:107407139-107407161 TGCATATGGCCCTCAGTAGGCGG + Intronic
1047739231 8:127793995-127794017 TGGAGCTGGAGCTCAGTCGGCGG + Intergenic
1053015314 9:34658572-34658594 TCCAGCTGGCTCGCAGGCGTCGG - Exonic
1053167531 9:35855014-35855036 TCCATCTGGTCCCCAGTCAGAGG + Intergenic
1054865886 9:70000558-70000580 TTCAGCTTGCTCTCAGTGGGTGG + Intergenic
1056065115 9:82925462-82925484 TTCTGCTGGCTGTCAGTCGGAGG - Intergenic
1057313852 9:93956955-93956977 TCAGGCTGGCCCTCAGTCCCTGG + Intergenic
1062271435 9:135711543-135711565 TGCAGCTGGCTCTCAGTCCATGG + Intronic
1062548087 9:137072701-137072723 CCCAGCTGGCCCTTGGTCTGTGG + Intergenic
1186410215 X:9340261-9340283 TCCAGCTGGCTCTCAGGCTATGG + Intergenic
1192366338 X:70476875-70476897 TCCAGCTGCCCATCAGTCTCTGG - Intronic
1195379809 X:104259865-104259887 GCCAGCTAGCCCTCAGCCAGGGG - Intergenic
1199679270 X:150214315-150214337 TCCAGGTGGGCCTCAGTGGGAGG + Intergenic
1200182083 X:154156705-154156727 TCCAGCTGGCCCTTAGCAGAAGG + Intronic