ID: 945135085

View in Genome Browser
Species Human (GRCh38)
Location 2:206618284-206618306
Sequence CCCCATTGGAGACCAGGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945135074_945135085 -1 Left 945135074 2:206618262-206618284 CCCACCCTCTATAATCCCCACTC 0: 1
1: 0
2: 0
3: 19
4: 210
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135070_945135085 7 Left 945135070 2:206618254-206618276 CCCCACCTCCCACCCTCTATAAT 0: 1
1: 0
2: 3
3: 35
4: 419
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135069_945135085 8 Left 945135069 2:206618253-206618275 CCCCCACCTCCCACCCTCTATAA 0: 1
1: 1
2: 5
3: 97
4: 807
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135067_945135085 19 Left 945135067 2:206618242-206618264 CCACTTCTTACCCCCCACCTCCC 0: 1
1: 0
2: 15
3: 214
4: 1905
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135068_945135085 9 Left 945135068 2:206618252-206618274 CCCCCCACCTCCCACCCTCTATA 0: 1
1: 1
2: 10
3: 173
4: 1306
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135072_945135085 5 Left 945135072 2:206618256-206618278 CCACCTCCCACCCTCTATAATCC 0: 1
1: 0
2: 7
3: 143
4: 1103
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135077_945135085 -6 Left 945135077 2:206618267-206618289 CCTCTATAATCCCCACTCCCCAT 0: 1
1: 0
2: 1
3: 29
4: 245
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135075_945135085 -2 Left 945135075 2:206618263-206618285 CCACCCTCTATAATCCCCACTCC 0: 1
1: 0
2: 1
3: 32
4: 298
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135073_945135085 2 Left 945135073 2:206618259-206618281 CCTCCCACCCTCTATAATCCCCA 0: 1
1: 0
2: 2
3: 35
4: 404
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135066_945135085 20 Left 945135066 2:206618241-206618263 CCCACTTCTTACCCCCCACCTCC 0: 1
1: 0
2: 3
3: 76
4: 814
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135065_945135085 21 Left 945135065 2:206618240-206618262 CCCCACTTCTTACCCCCCACCTC 0: 1
1: 0
2: 4
3: 65
4: 595
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135076_945135085 -5 Left 945135076 2:206618266-206618288 CCCTCTATAATCCCCACTCCCCA 0: 1
1: 0
2: 3
3: 47
4: 369
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166
945135071_945135085 6 Left 945135071 2:206618255-206618277 CCCACCTCCCACCCTCTATAATC 0: 1
1: 1
2: 4
3: 60
4: 670
Right 945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945135085 Original CRISPR CCCCATTGGAGACCAGGCCA GGG Exonic
900697041 1:4018996-4019018 CCCCATTGGATGTCAGGCCAAGG + Intergenic
902376963 1:16034484-16034506 CCCCAGCAGAGACCAGGCCAAGG + Intergenic
902382133 1:16057743-16057765 CCCCAGCAGAGACCAGGCCAAGG + Intergenic
902434795 1:16391559-16391581 CCAAATTGGAGACCAGGACGTGG + Intronic
902837694 1:19057789-19057811 GCCTCATGGAGACCAGGCCATGG + Intergenic
903875232 1:26469357-26469379 CCCTATTGGTGACCAGACCTAGG - Exonic
904344164 1:29857244-29857266 ACCCAAAGGAGAGCAGGCCATGG + Intergenic
904598815 1:31662718-31662740 CACCCATGGAGACCAGGCCCTGG + Intronic
905918810 1:41705274-41705296 CATCATTGCAGGCCAGGCCAGGG - Intronic
906320498 1:44812738-44812760 CCCTACAGGAGACCACGCCATGG - Intronic
907268642 1:53277505-53277527 ACGCCTTGGATACCAGGCCAGGG - Intronic
910114479 1:83716921-83716943 CCACAGTGGGGACCAGCCCAAGG + Intergenic
913328863 1:117650929-117650951 CCCCAATGGAGGGCAGACCAAGG - Intergenic
914424065 1:147558472-147558494 CACCAGAGGAGACCAGACCAAGG - Intronic
914648349 1:149675070-149675092 GCCCATGGGAGCCCAGGTCATGG + Intergenic
922715705 1:227870113-227870135 GCCCACTGCAGACCAGACCATGG + Intergenic
922766564 1:228159247-228159269 CCCCAGTGGTGACCAAGCCAGGG - Exonic
1065067839 10:21989702-21989724 CCACAGTCCAGACCAGGCCAAGG + Intronic
1066578979 10:36859319-36859341 CTCCAGTGGAGACGAGGCCCAGG - Intergenic
1067292442 10:44953635-44953657 CCCCACAGGAGAACAGCCCAAGG + Intergenic
1067929088 10:50541622-50541644 CCCACTTGGAGACAAGACCAGGG + Intronic
1068966603 10:62918165-62918187 GCCTTTTGGAGACCAGGCCTTGG + Intronic
1069068166 10:63967292-63967314 CCACATTGGAGAGCAATCCATGG + Intergenic
1070549586 10:77480614-77480636 CACATTTGGAGACCAGGCTATGG + Intronic
1070833813 10:79435815-79435837 CCCCGTTTGAGCTCAGGCCAGGG + Intronic
1072793057 10:98332782-98332804 CCCCATAGGAGAAGAGACCAAGG + Intergenic
1076260461 10:129060896-129060918 TCCCTTTGGAGACCAGGCCCAGG + Intergenic
1077108595 11:852499-852521 CCCCACTGGGCACCAGCCCAGGG - Intronic
1079388104 11:19998531-19998553 CCCCCTTGGAGGCCACGGCAAGG - Intronic
1080441745 11:32300704-32300726 CCCCATTTGAGATGAGTCCAGGG - Intergenic
1084660295 11:70542788-70542810 GCCCATTGGAAACCCCGCCAGGG - Intronic
1089402530 11:118172584-118172606 TCCCATTTGAGACCAGGTCTGGG + Intronic
1092778118 12:11961801-11961823 CCCCATTTTGGTCCAGGCCAGGG - Intergenic
1096207297 12:49733775-49733797 CCCCTTTGGAGACCAAGCCAAGG - Intronic
1096561692 12:52440107-52440129 CCCCATTGGTGGCCAGGCTGTGG + Intergenic
1099933498 12:89099638-89099660 CCCAGATGGAGAACAGGCCATGG + Intergenic
1100024518 12:90111577-90111599 CCCTATTGAAGACCAGGCACAGG - Intergenic
1103347852 12:120263335-120263357 CCCCTTGGGAGCTCAGGCCAAGG + Intronic
1103585937 12:121955827-121955849 ATCCAGTGGAGACCAGGCCTGGG + Intronic
1103934134 12:124466366-124466388 CCCCCTTGCAGCCCGGGCCACGG + Intronic
1104959725 12:132482958-132482980 CCCCATGTGAGACCAGGGGATGG - Intergenic
1105898870 13:24740399-24740421 CCTCTCTGGAGAACAGGCCAGGG - Intergenic
1111045207 13:82805561-82805583 CCCCATAGGAGCTCAGGCCCAGG - Intergenic
1113018936 13:105860173-105860195 GCCCACTGGAGACCAAGCCCAGG + Intergenic
1114582540 14:23775579-23775601 CCCCGCTGGTGTCCAGGCCATGG - Intergenic
1121509179 14:94499789-94499811 TCCCACTGTGGACCAGGCCAAGG - Intronic
1122552981 14:102560190-102560212 CCCCAGTGGAGACAGAGCCAGGG + Intergenic
1123758566 15:23415735-23415757 CCCCAGCAGAGATCAGGCCAGGG + Intergenic
1124690505 15:31817744-31817766 CCCCTTTGCAGCCCAGGCCAAGG - Intronic
1128934967 15:71738348-71738370 CCCCAATCGACACCAGTCCATGG - Intronic
1131045055 15:89307799-89307821 ACCCATCAGAGACCAAGCCAAGG + Intronic
1131835673 15:96388347-96388369 ACCCGGTGGAGACCTGGCCAAGG - Intergenic
1132871858 16:2118904-2118926 CCCCACTGGCAACCAGGCCCTGG + Intronic
1134457772 16:14407136-14407158 CCCCAGCAGAGATCAGGCCAGGG - Intergenic
1134520669 16:14917992-14918014 CCCCACTGGCAACCAGGCCCTGG - Intronic
1134550906 16:15137982-15138004 CCCCACTGGCAACCAGGCCCTGG + Intronic
1134708341 16:16316643-16316665 CCCCACTGGCAACCAGGCCCTGG - Intergenic
1134715556 16:16356676-16356698 CCCCACTGGCAACCAGGCCCTGG - Intergenic
1134951261 16:18352002-18352024 CCCCACTGGCAACCAGGCCCTGG + Intergenic
1134959201 16:18395483-18395505 CCCCACTGGCAACCAGGCCCTGG + Intergenic
1137350681 16:47711725-47711747 TCCCACTGGAGACCTGGACATGG - Intergenic
1138441496 16:57037611-57037633 CTCCCTGGGAGACTAGGCCAAGG + Intronic
1138522298 16:57577892-57577914 CCCCACTGGGGTCCAGGCCCTGG + Intronic
1139335956 16:66231424-66231446 TCCCAGCGGAGAGCAGGCCAGGG + Intergenic
1142912899 17:3111103-3111125 TCCCATTGGACCCCAGGCCCTGG - Intergenic
1142973714 17:3630503-3630525 CCCCAGTGGAGGGCAGGCCCAGG - Intronic
1143865271 17:9918668-9918690 CCGCAATAGAGACCGGGCCAGGG + Intronic
1144058712 17:11562624-11562646 CCCCCTCGGAGACAAAGCCAGGG - Exonic
1144395412 17:14838254-14838276 TGCCATAGGAGACCAGGCCCTGG - Intergenic
1144623910 17:16834715-16834737 CCCCAGTGGAGCCCAGGCAGAGG - Intergenic
1144882519 17:18438001-18438023 CCCCAGTGGAGCCCAGGCAGAGG + Intergenic
1145149715 17:20506385-20506407 CCCCAGTGGAGCCCAGGCAGAGG - Intergenic
1145259643 17:21347108-21347130 CTCCAGGGGAGTCCAGGCCAGGG - Intergenic
1145316972 17:21740840-21740862 CTCCAGGGGAGCCCAGGCCAGGG + Intergenic
1147725324 17:42563158-42563180 CTGCTTTGGAGACCCGGCCACGG - Exonic
1148085295 17:44990263-44990285 GCCCAGTGGAGGTCAGGCCAAGG + Intergenic
1151049291 17:70958439-70958461 CCCCATTAAAAAGCAGGCCAAGG - Intergenic
1151722476 17:75865348-75865370 CCCCATGTGAGACCATGCCCTGG + Intergenic
1151821589 17:76499879-76499901 CCCCCTTGCAGCCCAGGCCTGGG - Intronic
1152070913 17:78133183-78133205 CCCCATTGGTGACCACTCGATGG - Intronic
1152255241 17:79235294-79235316 TCCCCGAGGAGACCAGGCCATGG + Intronic
1152291672 17:79443286-79443308 CCACGGGGGAGACCAGGCCAAGG + Intronic
1152626037 17:81388407-81388429 CCCCATGGGAGCCATGGCCAAGG + Intergenic
1152901475 17:82943518-82943540 CCCCACCTGAGAGCAGGCCAGGG - Intronic
1156381149 18:36562619-36562641 CCTCATTGGAGAGCAGGACGTGG + Intronic
1157522022 18:48352009-48352031 GACCATGGGAGACCAGGCCAAGG - Intronic
1158969264 18:62651191-62651213 GCCCAGTGGAGAACAGGGCAAGG + Intergenic
1160727797 19:625251-625273 CACCCTGGGAGACCAAGCCAGGG + Exonic
1161707556 19:5829243-5829265 CCCCCGTGGAGGCCCGGCCAGGG - Intergenic
1168634997 19:57989256-57989278 CCCCAGAGCAGCCCAGGCCAAGG + Intronic
925205586 2:2003181-2003203 CCCCCATGCAGAGCAGGCCATGG - Intronic
926588442 2:14714802-14714824 TCCTACTGGACACCAGGCCACGG + Intergenic
928363866 2:30686951-30686973 CCCCATTGGAGACCACCTCCAGG - Intergenic
932268169 2:70386234-70386256 GCTCATTTGGGACCAGGCCAGGG + Intergenic
933998925 2:87690200-87690222 TCCAATCTGAGACCAGGCCAGGG - Intergenic
936294921 2:111260683-111260705 TCCAATCTGAGACCAGGCCAGGG + Intergenic
937207449 2:120245771-120245793 TCCCAGTGGGGACCAGGCCTTGG + Intronic
937262821 2:120597290-120597312 CCACATTTGAGCTCAGGCCAGGG + Intergenic
937448012 2:121975137-121975159 GCCCATTGGAGTCCACACCAAGG + Intergenic
938298270 2:130192073-130192095 CCCCGGGGGAGACCTGGCCAAGG - Exonic
938458497 2:131482584-131482606 CCCCGGGGGAGACCTGGCCAAGG + Exonic
938490836 2:131760204-131760226 CCCAAATGAAGACCAGGCCCAGG - Intronic
939184807 2:138847700-138847722 CCCCTTTGCAGGCCAGTCCAGGG + Intergenic
944299330 2:198104853-198104875 CCCCATTAGAAAGCAGGCAAAGG - Intronic
945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG + Exonic
948061365 2:235045114-235045136 CCCGTGAGGAGACCAGGCCACGG - Intronic
1174177202 20:48652607-48652629 CCCCAGTGGCGAGCAGGCCCAGG - Exonic
1175213315 20:57375416-57375438 CCCCATCGGAAGCCAGGGCAGGG - Intronic
1175539123 20:59737178-59737200 CCCCAGTGGGGAACAGGACAGGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176110896 20:63410270-63410292 CCCAATAGGAGCCCTGGCCACGG + Intronic
1176676085 21:9778771-9778793 CCAGATTGGAGAGCAGGCCCAGG + Intergenic
1178922274 21:36746616-36746638 CCACATTGGTGACCAGGGCCAGG + Intronic
1179994591 21:44968069-44968091 CCCCACTGGGGTCCAGGCCCAGG - Intronic
1180751975 22:18130875-18130897 CCCCGGGGGAGACCTGGCCAAGG + Exonic
1181752804 22:25001488-25001510 CCCCAATGTGGACCAGGCCAAGG + Intronic
1182733485 22:32513745-32513767 CCCAAGTGAAGACGAGGCCAAGG - Exonic
1182782633 22:32880414-32880436 CCCCCCTGTAGACCAGGCCAAGG - Intronic
1182965450 22:34517341-34517363 CTCAATTAAAGACCAGGCCAGGG - Intergenic
1183217746 22:36492112-36492134 GCCCCTGGGAGGCCAGGCCATGG + Intronic
1184890301 22:47375142-47375164 CCCAACCAGAGACCAGGCCACGG + Intergenic
950476110 3:13215910-13215932 CCCCAGAGCAGACCAGGCCCGGG + Intergenic
950892080 3:16413180-16413202 ACCCACTGGTGACCAGGCCTAGG + Intronic
951106243 3:18746748-18746770 CTCCATTTGAGAACAGGCAATGG - Intergenic
954445856 3:50546583-50546605 CCCCATTGGAGACCACAACAAGG + Intergenic
954684882 3:52365063-52365085 CCACCTTGGAGTCCAGGTCAGGG + Intronic
954693232 3:52406906-52406928 CCCTAGTGGAGACCAAGACAAGG + Exonic
958821140 3:98975229-98975251 CCCCATTAAAAACCAGGCAAAGG + Intergenic
961726361 3:128933478-128933500 GCCCACTGCACACCAGGCCATGG - Intronic
963051521 3:141147643-141147665 CCCCGTTGCAGACAGGGCCAGGG + Exonic
968708157 4:2093268-2093290 CCCCACTGGGGACAAGGCCGGGG + Intronic
968783181 4:2598839-2598861 CACCATCGGAGACCTTGCCAAGG - Intronic
969687544 4:8684127-8684149 CCCAAGAGGAGAGCAGGCCAAGG - Intergenic
971331702 4:25686755-25686777 CCCCATTGGTGGCCAGGCCTGGG - Intergenic
980744640 4:136999128-136999150 CCCCATTGGGGCTCAGGCAAAGG + Intergenic
986124805 5:4875065-4875087 CTCCATGGGAGAACTGGCCAAGG + Intergenic
986735135 5:10662703-10662725 CCCCATGGGCCTCCAGGCCATGG - Intergenic
986813260 5:11382216-11382238 CCTCATTTGAAACAAGGCCAAGG + Intronic
987927737 5:24364333-24364355 CCACATTGGAGACCAGCCCCTGG + Intergenic
994055046 5:95405700-95405722 CTCCATTGGAGACCAGGATCTGG - Intronic
997732052 5:136188831-136188853 CACCTTTGGAGAGCAGGGCATGG - Intergenic
1001140013 5:169136705-169136727 TCCCATTGGAGAATGGGCCAGGG + Intronic
1001281422 5:170389087-170389109 CCCCACTGGCCACCAGACCACGG + Intronic
1002134769 5:177100795-177100817 GCACATTGGAGACCAGACCCAGG + Intergenic
1002189520 5:177471462-177471484 CCCCATTGGAGGCAAGGTAAGGG + Intronic
1006319847 6:33313926-33313948 CCCCACTGGAGCCGATGCCAGGG - Intronic
1006630025 6:35424294-35424316 CCCCGTTAGAGATCAGGCCTCGG - Intronic
1007602380 6:43090568-43090590 CTCCACTGGAGACCTGGCTAGGG - Intronic
1011700485 6:89950552-89950574 CCCCCTTGGAGACCAGGACCAGG - Exonic
1013271250 6:108547353-108547375 CCTCACTGGGGACCAGGCCCTGG - Intergenic
1019759084 7:2795860-2795882 CTCCATTGCACTCCAGGCCAGGG - Intronic
1023842713 7:44106090-44106112 CCCCGTAGGAGACCAGGGGAAGG + Intronic
1023875781 7:44285506-44285528 CCACATGGGAGTCCAGGCCAAGG + Intronic
1025744186 7:64228356-64228378 CCCCAATGGAGGCCAAGACAAGG + Intronic
1025751401 7:64296762-64296784 CCCCAATGGAGGCCAAGACAAGG + Intergenic
1030983146 7:116210339-116210361 TCCCTTCGGAGACCAGGTCAGGG + Intergenic
1032162025 7:129518334-129518356 CCCCAACAGAGACGAGGCCACGG + Intergenic
1032436656 7:131906434-131906456 CCCCACTTCAGGCCAGGCCAGGG - Intergenic
1033291756 7:140091047-140091069 TCCCTTTGGAGACCAGTCTAGGG - Exonic
1033494107 7:141876766-141876788 CCCCATTGCAGTCCAAGCCTTGG - Intergenic
1035082005 7:156224148-156224170 TCCCAGGGGAGACCAGCCCATGG + Intergenic
1037989437 8:23309885-23309907 CCGCATTGAGGACCAGGTCAGGG + Exonic
1041414407 8:57591630-57591652 TCCCATGAGAGATCAGGCCAAGG - Intergenic
1044533747 8:93337056-93337078 CCCCAGTGGAGACCAGGGGCTGG - Intergenic
1044902244 8:96959130-96959152 CCCCACTGGAGACAAAGCCTTGG - Intronic
1049197502 8:141323816-141323838 CCCCACTGGGGCCCAGGCCAGGG - Intergenic
1049587055 8:143437118-143437140 CCCGAGTGTGGACCAGGCCAAGG + Intergenic
1049594114 8:143475663-143475685 CCCCTTGGGAGGCCAGGCCTGGG - Intronic
1049812629 8:144582294-144582316 CACCCTTTGAAACCAGGCCAGGG + Intronic
1049957935 9:710820-710842 TCTCAGTGGAGACCAGGACAAGG + Exonic
1051143976 9:14007426-14007448 CCCCGTTGGAGCCCTAGCCAGGG - Intergenic
1054712995 9:68530113-68530135 CCCCATTGTAGACCTGACCTAGG - Exonic
1056576599 9:87859671-87859693 GCCCAGTGGACACCTGGCCACGG - Intergenic
1186623622 X:11268293-11268315 CCGCACTGGATACCAGGCTAAGG - Intronic
1186728365 X:12381830-12381852 CACCATTGGGTTCCAGGCCATGG - Intronic
1195919090 X:109964553-109964575 GCCCATTCCATACCAGGCCATGG - Intergenic
1199597716 X:149521014-149521036 CCCCATTAAAAACCAGGCAAAGG + Intronic
1200707794 Y:6457554-6457576 CCCAAATGTACACCAGGCCATGG + Intergenic
1201026318 Y:9707154-9707176 CCCAAATGTACACCAGGCCATGG - Intergenic
1201414657 Y:13736066-13736088 CCCAAGTGGACACCAGGCCAGGG + Intergenic
1202173949 Y:22080335-22080357 GACAACTGGAGACCAGGCCATGG - Intronic
1202217411 Y:22506047-22506069 GACAACTGGAGACCAGGCCATGG + Intronic
1202325775 Y:23690012-23690034 GACAACTGGAGACCAGGCCATGG - Intergenic
1202544996 Y:25980042-25980064 GACAACTGGAGACCAGGCCATGG + Intergenic