ID: 945143551

View in Genome Browser
Species Human (GRCh38)
Location 2:206713318-206713340
Sequence TGTACAGTAGATCTCTTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945143551 Original CRISPR TGTACAGTAGATCTCTTGAT TGG Intronic
901255243 1:7819384-7819406 GATACAGTTGATCTGTTGATAGG - Exonic
903574576 1:24331016-24331038 TCTTCAGTAGAACTCATGATGGG + Intronic
904695038 1:32325068-32325090 TGTACATAAGATCTCTTAGTAGG - Intronic
907433123 1:54425952-54425974 TGTAGACCACATCTCTTGATGGG + Intergenic
911781967 1:101892201-101892223 AGTACAATACATCTCTTGCTTGG - Intronic
917238896 1:172925440-172925462 TGTCCATTAGAGCTCTTGAGTGG + Intergenic
919267055 1:195282747-195282769 TGGACAGTAGATCTCTTGAAAGG - Intergenic
924202816 1:241677601-241677623 TATACAGTAGCTCTCTGCATGGG + Intronic
1065453459 10:25882219-25882241 AGTATAGTATATCTCTTCATAGG - Intergenic
1065501646 10:26388960-26388982 TGTACATTAGTTCTGTTGTTAGG - Intergenic
1071419424 10:85476894-85476916 AGTCCAGTAGTTCTCTTGTTTGG + Intergenic
1072895870 10:99366243-99366265 TGTTCAGTAGAACTCTGGATGGG + Intronic
1073066155 10:100760386-100760408 TGGACAGTAGACATCCTGATGGG + Intronic
1076172462 10:128333217-128333239 TGTACAGTAGATCTCAAAAATGG - Intergenic
1080460118 11:32447287-32447309 TTGACAGTAGCTCTGTTGATGGG - Intergenic
1092086717 12:5768697-5768719 TGTACGGTAGGTCTCCTGACTGG + Intronic
1092321443 12:7480590-7480612 TGTACATTAGACCTCTAGACTGG - Intronic
1093303132 12:17478546-17478568 TGTACAATATATCTCTTGAGGGG + Intergenic
1095750917 12:45710094-45710116 TTAACATTAGATGTCTTGATAGG + Intergenic
1097834085 12:64256186-64256208 TGTACAGCATATCTCTAGAAAGG - Intergenic
1098968006 12:76814423-76814445 ATTACAATAGATCTCTTGAGAGG + Intronic
1099653984 12:85466285-85466307 TGTCCAGTTGATCACTTGACTGG - Intergenic
1107632475 13:42356128-42356150 TGTACTATACATCTCTTTATAGG + Intergenic
1111642666 13:90989658-90989680 TATATATTAGATCTTTTGATAGG - Intergenic
1113202551 13:107883102-107883124 TGTAAAGTAGGTCTATTTATTGG + Intergenic
1113240645 13:108333123-108333145 TGTATAGTAGAGCTATTGATCGG - Intergenic
1115062096 14:29204756-29204778 TGTACCTTAAATCTCTTAATAGG - Intergenic
1115681977 14:35750611-35750633 TGTACAATAGATTGCTTCATTGG + Exonic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1123771716 15:23535950-23535972 TGGAAAGGAGTTCTCTTGATGGG + Intergenic
1127626583 15:60786187-60786209 TGTACAGGAGTGCTCTGGATAGG + Intronic
1129595349 15:76959538-76959560 TGTACTGTAGGTATCTTGCTGGG + Intergenic
1130731923 15:86503842-86503864 TGTAGAGTAGATCACATGGTTGG - Intronic
1133471469 16:6080082-6080104 TGTACAGTGGATATCTTGAAGGG + Intronic
1139146180 16:64328068-64328090 TGATCAGTAGAACTCTTGATAGG + Intergenic
1139682257 16:68574131-68574153 TGTCCAGTAGGTCACATGATAGG - Intronic
1141072112 16:80966963-80966985 TTTTCTGTAGATCACTTGATAGG - Exonic
1150090440 17:62319860-62319882 TTTACAGTAGCTCTCTTGGTAGG - Intergenic
1156068632 18:33176439-33176461 TAGAGAGTAAATCTCTTGATGGG - Intronic
1156841469 18:41614659-41614681 TGTAAAATAGATGTCTTGCTTGG + Intergenic
1159821419 18:73150180-73150202 AGTACAATAAAACTCTTGATTGG + Intergenic
1160084293 18:75760442-75760464 TGTACATTACATCTCTAGACTGG + Intergenic
1163954821 19:20627624-20627646 TTGAAAGTATATCTCTTGATTGG - Intronic
1165002585 19:32777349-32777371 TGTACAGTATATCTCCTGTAGGG + Intronic
926720058 2:15953251-15953273 TGTAAAGGAAATCTCTTCATAGG + Intergenic
927397420 2:22669902-22669924 TATAAAGTAGCTTTCTTGATAGG - Intergenic
928934289 2:36658621-36658643 AGAACAGTAGATCTCCTGATTGG - Intergenic
935921552 2:108021248-108021270 TGTACATTAGAGCCCTTGCTGGG - Intergenic
936958940 2:118052884-118052906 TGTACAGTAGATCGAGTTATAGG + Intergenic
937560798 2:123221489-123221511 TGTACTGTCCATCTCTTGAATGG - Intergenic
939003377 2:136760348-136760370 TGGACAGTAGGTCCCTTTATAGG - Intergenic
940502399 2:154509372-154509394 TGTACAGGGGATCTCTTAAAAGG + Intergenic
941460040 2:165759933-165759955 TGTACAATAGATCTCCAGAAGGG + Intronic
941860893 2:170279166-170279188 TGTACAGTAGTTCTATTTTTAGG + Intronic
942263072 2:174191027-174191049 TGTACAATAGAGCTCTTGAATGG - Intronic
944136923 2:196409872-196409894 TATACAGTAAATCCCTTGAAGGG + Intronic
945143551 2:206713318-206713340 TGTACAGTAGATCTCTTGATTGG + Intronic
945292808 2:208142692-208142714 AGTACAGGAGGTTTCTTGATTGG - Exonic
1177377634 21:20293877-20293899 TGTATTGTAGATTTCTTGAGTGG + Intergenic
1177951954 21:27549509-27549531 TGTATAGTATATCTTTTAATAGG - Intergenic
1179199615 21:39204331-39204353 TGTGCAGTATATCCCTTGATGGG - Intronic
951920021 3:27844095-27844117 AGCACAATATATCTCTTGATTGG + Intergenic
955922020 3:63967113-63967135 TTGACAGTAGATTTGTTGATTGG + Intronic
956673360 3:71712098-71712120 TTTACAGTAGATTTCTTTATTGG - Intronic
956782839 3:72617941-72617963 AGAACAGTAGATTTCTGGATGGG - Intergenic
956840473 3:73135282-73135304 TTCACAGTAGGTCTCTTGCTGGG + Intergenic
958850515 3:99319379-99319401 TCTCCAGTAGATCCCTTGTTGGG + Intergenic
961575499 3:127832693-127832715 TGCACAGAAGATATCTTGAAAGG - Intergenic
963943229 3:151116218-151116240 TGTAGAGGAGAACTCTTGAAAGG - Intronic
964893370 3:161563524-161563546 TGTACAACAAATCTCATGATTGG + Intergenic
980332421 4:131426716-131426738 GGTACAGTACATCGCTTGGTTGG - Intergenic
981474951 4:145179516-145179538 TGTACAGTTGATTTATTGCTGGG - Intronic
981992797 4:150943207-150943229 TGTGCAGTAGACATCTTGAAAGG + Intronic
983142466 4:164169000-164169022 TGTACATTAGATCTCTAAACTGG - Intronic
986765135 5:10918743-10918765 TGTACAATAGACGTCTTGAATGG + Intergenic
989312249 5:40033673-40033695 TGGGCAGCAGATCTCTTGACAGG + Intergenic
989761137 5:45018363-45018385 TGTATAGTAGATTTCATTATTGG + Intergenic
994552084 5:101247707-101247729 TGTCCAGTCCATCTCATGATTGG - Intergenic
996177881 5:120381423-120381445 TGAACAGTAGATCTCAACATGGG + Intergenic
1000570563 5:162908197-162908219 TTTTCAGTTGATATCTTGATAGG - Intergenic
1001796870 5:174509678-174509700 TGTCCAGTGGATGTCTGGATGGG - Intergenic
1001848748 5:174944213-174944235 TGGGCATTAGATCTCTTCATGGG - Intergenic
1006894419 6:37457972-37457994 TGTTCAGTAGGACTCTTGAAAGG + Intronic
1007211890 6:40199147-40199169 TGTACATTAGAGCTCTAGACTGG + Intergenic
1012634386 6:101517600-101517622 AGTACAGTATATCTCTAGTTGGG - Intronic
1013721425 6:113034208-113034230 TGGACAATATATCTTTTGATAGG - Intergenic
1015568706 6:134600208-134600230 TGTAGAATAGTTCTCTTCATGGG - Intergenic
1019106683 6:169673593-169673615 TTTATAGTAGATATCTTTATGGG - Intronic
1030414551 7:109226038-109226060 GGTACAGTATGTCACTTGATTGG - Intergenic
1032637082 7:133721097-133721119 TGTATAGTACATATTTTGATGGG - Intronic
1038233513 8:25728828-25728850 TGGACACTTGATCTCTTGCTTGG - Intergenic
1045702801 8:104886243-104886265 TGTGCAGTATATCACTTGGTAGG + Intronic
1046154009 8:110263813-110263835 TATAGAGTTGATATCTTGATAGG - Intergenic
1046154077 8:110264280-110264302 TATAAAGTAGATATCTGGATTGG + Intergenic
1046876731 8:119263046-119263068 TATACAGTAGATCTCAGGAGAGG + Intergenic
1050951263 9:11598650-11598672 TGTACAATAAATCTCTTCCTTGG + Intergenic
1053605645 9:39655909-39655931 TGTAAATCAGATCTCTAGATGGG - Intergenic
1056905771 9:90646438-90646460 TTTACAGGAGATATGTTGATAGG - Intergenic
1058162667 9:101586577-101586599 TCAACAGTAGATCCCTAGATTGG - Intronic
1058492895 9:105521113-105521135 TGTACAATAGATTGCTTCATTGG - Intronic
1059358669 9:113721291-113721313 TGTATGATAGATCTCTTGAAAGG + Intergenic
1059361539 9:113746053-113746075 AATACAGATGATCTCTTGATGGG + Intergenic
1192529931 X:71875195-71875217 TGTACAGGCTATCTCTTGCTTGG + Intergenic
1192894930 X:75432639-75432661 TGTATAGTAGGTCTTTTGAGGGG - Intronic
1193669742 X:84369624-84369646 TTTACAGTAGATATCCTAATTGG + Intronic
1194686951 X:96931964-96931986 TGCACAGTTAATCTCTAGATGGG - Intronic
1195125246 X:101802541-101802563 TGTACAGCAGATCTGTTATTAGG - Intergenic
1195980650 X:110574506-110574528 TGTACAATGGCTCTCTTGAGAGG + Intergenic
1200706389 Y:6446317-6446339 TGTCCAGTAGTGCTGTTGATGGG + Intergenic
1200709953 Y:6474325-6474347 TGTCCAGTAGTTCAGTTGATGGG + Intergenic
1200984424 Y:9290695-9290717 TGTCCAGTAGTTCTGTTGAGAGG + Intergenic
1201024162 Y:9690383-9690405 TGTCCAGTAGTTCAGTTGATGGG - Intergenic
1201027723 Y:9718391-9718413 TGTCCAGTAGTGCTGTTGATGGG - Intergenic
1202125376 Y:21564889-21564911 TGTCCAGTAAAGCTATTGATGGG - Intergenic
1202126018 Y:21569549-21569571 TGTCCAGTAGTTCTGTTGAGAGG - Intergenic
1202153632 Y:21864503-21864525 TGTCCAGTAAAGCTATTGATGGG + Intergenic