ID: 945143765

View in Genome Browser
Species Human (GRCh38)
Location 2:206715101-206715123
Sequence CTGCTCACTGTGGCTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945143765 Original CRISPR CTGCTCACTGTGGCTGGAAT GGG Intronic
900970322 1:5989060-5989082 CTGCAGTCTCTGGCTGGAATCGG - Intronic
903572142 1:24313857-24313879 CTGTGCACTGGGGCTGGAAATGG + Intergenic
904470264 1:30731691-30731713 CTGCTCAGCGTGGCTGCAAGTGG - Intergenic
906098315 1:43239160-43239182 CTGGTCACTGTGCCAGGCATGGG - Intronic
906165705 1:43684594-43684616 CAGCTCAGTGTGGCTGGAGCTGG + Intronic
906740916 1:48183024-48183046 CAGTTTACTGTGGCTGGAATGGG + Intergenic
907314284 1:53558656-53558678 CTGGGCACTGTGGCATGAATGGG - Intronic
910516439 1:88066498-88066520 CTGCTCTCTTTGGTTGGAACTGG - Intergenic
912007592 1:104923241-104923263 CTGTTCACCGTGTCTGGTATGGG + Intergenic
912960651 1:114192510-114192532 CTGCTCCTAGTGGCAGGAATTGG - Intergenic
914958638 1:152187133-152187155 CTGCTCACTCTTCCTGGAAAAGG - Intergenic
915266401 1:154721180-154721202 CTGCTCACTGTGGCTTGATGTGG + Intronic
915662270 1:157414394-157414416 TTGCTTGCTGTGGCTGCAATGGG + Intergenic
918195105 1:182213762-182213784 CTGCTAACTGTTCCTGGCATGGG + Intergenic
919201199 1:194357635-194357657 ATGCTTACTGTGTCCGGAATTGG + Intergenic
920381252 1:205535793-205535815 CTGCTCACTGCGGCTCGACCTGG - Intergenic
921171125 1:212550845-212550867 TAGCTCACTGTAGCTTGAATTGG + Intergenic
921644163 1:217593568-217593590 CTGCCAACTGTAGCAGGAATTGG - Intronic
921903656 1:220474820-220474842 GTGATCACTGTGCCTGGAAATGG - Intergenic
922501327 1:226098917-226098939 CACCTCACTGTGGCTGGGATAGG - Intergenic
922544467 1:226445579-226445601 CTTCTCACTGAGGCTGAACTGGG - Intergenic
922619603 1:226981695-226981717 GTGCTGCCTGTGGCTGGAAGGGG - Intronic
922979906 1:229816852-229816874 TTGCTCATGGTGGCTGGAAGAGG + Intergenic
1066043745 10:31578833-31578855 CTGCTCCCTGTGGCTTGATATGG - Intergenic
1066554456 10:36595853-36595875 CTGCTTAGTGTGGCTGACATTGG - Intergenic
1068080032 10:52308798-52308820 GTGCTCACGGTGGCTGCACTTGG - Intergenic
1068434748 10:56975697-56975719 CTGCTCACTGTGCCAGGATAAGG + Intergenic
1068774210 10:60853727-60853749 TTGGCCATTGTGGCTGGAATTGG + Intergenic
1069183799 10:65396834-65396856 CTGGACACTGTGTCTGGGATAGG - Intergenic
1071522414 10:86339471-86339493 CTGCACCCTGTGGCTGGGCTAGG + Intronic
1072005651 10:91244307-91244329 CTGCTCCCTTTACCTGGAATAGG - Intronic
1072231513 10:93417782-93417804 CTGGTCACCCTGGCTGGACTGGG + Intronic
1073186486 10:101618314-101618336 CTGACCCCTGTGGCTGGAGTTGG - Intronic
1073448726 10:103596835-103596857 CAGATCTCTGTGCCTGGAATGGG - Exonic
1074156279 10:110802720-110802742 GTGCTCACCGTGGGTGGAACTGG + Intronic
1074728120 10:116336320-116336342 AAGGCCACTGTGGCTGGAATGGG + Intronic
1078478173 11:11652289-11652311 CTACTCACTGTGGCTCTGATGGG + Intergenic
1080433217 11:32217314-32217336 CTGCTCAGTATGTCTGAAATGGG + Intergenic
1081520276 11:43874917-43874939 CTGCTCAGTGTTGCTGGGACAGG + Intergenic
1083641864 11:64149993-64150015 CTGCTCAGTGTGGCTGGCTGAGG - Intronic
1084596116 11:70118031-70118053 CTGGACTCTGAGGCTGGAATTGG - Intronic
1085055574 11:73401620-73401642 CTGCTATCAGTGGCTGGAATGGG + Intronic
1085769159 11:79309697-79309719 TGGCTCACTGGGGCTGGAAGGGG + Intronic
1087478480 11:98667869-98667891 AGGCTCACTGTGGCTGGGAGTGG - Intergenic
1087920228 11:103858506-103858528 CTGCTTTCTGTGACTGAAATGGG + Intergenic
1089589855 11:119533344-119533366 CCGCTCAGTGTGCCTGGAACAGG + Intergenic
1090117990 11:123994971-123994993 CTCCTCACTGTTTCTGGAAATGG - Exonic
1090893589 11:130949481-130949503 CTGCAGTCTGTAGCTGGAATTGG - Intergenic
1094246882 12:28308417-28308439 CAGATCACAGTGGCTGCAATGGG - Intronic
1094579726 12:31723317-31723339 TTGATCAGTGTGGCTGGAGTTGG - Intronic
1096514195 12:52147320-52147342 TTCCTCACTGTGGCAGGGATTGG + Intergenic
1097513135 12:60568260-60568282 CTGCTCTCATTGGCTGGCATTGG - Intergenic
1099605949 12:84801163-84801185 CCTCTCACTGTTTCTGGAATTGG + Intergenic
1100153738 12:91772858-91772880 CATCTGACTGTGGCAGGAATTGG + Intergenic
1100605954 12:96152320-96152342 CTTCTCACTGCAACTGGAATTGG + Intergenic
1104329248 12:127828825-127828847 CTCCTCACGGTGGCTGGCAGAGG - Intergenic
1106047531 13:26157696-26157718 GTCCTCACTGATGCTGGAATTGG - Intronic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1107342558 13:39423885-39423907 ATGCTCACTCTGGTTAGAATTGG + Intronic
1107622157 13:42244513-42244535 CTGCTCAGTGATGCTGGCATTGG - Intronic
1107877229 13:44801376-44801398 CTCCTCCCAGTGACTGGAATGGG + Intergenic
1111141652 13:84127362-84127384 CTGCTGACTTTGCCTGGAACTGG + Intergenic
1114530422 14:23392079-23392101 TTGCTCACAGTTGTTGGAATTGG + Intronic
1114828158 14:26106414-26106436 CTGATCACTGGGCCTGGAATAGG + Intergenic
1118351703 14:64976815-64976837 ATGCTCAGTGTGGCTGGGGTGGG - Intronic
1119620261 14:76126542-76126564 CTGCTCCATGTGGCTTGACTGGG - Intergenic
1119932767 14:78564278-78564300 CTTCACACTGAGGCGGGAATAGG - Intronic
1119998070 14:79274825-79274847 GTCCTCCCTGTGGCTGAAATAGG - Intronic
1120844337 14:89112830-89112852 CGCCCCACTGTGTCTGGAATTGG - Intergenic
1124102979 15:26712898-26712920 CTGCTTCCTGTGGCTGGCTTTGG - Intronic
1124394044 15:29285140-29285162 CTGCTCCCTGACGCTGGAGTGGG + Intronic
1126142540 15:45449965-45449987 AGGCAGACTGTGGCTGGAATGGG + Intergenic
1129236203 15:74225224-74225246 CTGCTCACTGGGGCTGGGGCTGG - Intergenic
1132939144 16:2498448-2498470 CTGCCCACAGAGGCTGGAAATGG + Intronic
1133866923 16:9652608-9652630 CTCTTCTCTGTGCCTGGAATTGG + Intergenic
1134644225 16:15853536-15853558 CTGCTCACAGTGGCTGAAAGGGG - Intronic
1135113510 16:19708262-19708284 TAGCGCACTCTGGCTGGAATGGG - Intronic
1137503293 16:49028242-49028264 TTGCTTACTGCAGCTGGAATGGG + Intergenic
1137551627 16:49441437-49441459 CTGCCCACTGCTGGTGGAATGGG - Intergenic
1137614734 16:49839424-49839446 CTGCTCCCTGTGCCTGGCACTGG - Intronic
1138007812 16:53354400-53354422 CTGCAAACTGTGGCAGTAATAGG - Intergenic
1138276287 16:55737278-55737300 CTGTTCCCTCTGCCTGGAATAGG - Intergenic
1138286731 16:55816006-55816028 CTGTTCCCTCTGCCTGGAATAGG + Intronic
1139281603 16:65775130-65775152 CTGCTCAGTGCGAATGGAATGGG + Intergenic
1140141647 16:72264018-72264040 CTGCTCTGTGTGGCTGGGATCGG + Intergenic
1142499914 17:326508-326530 CTGTGCACTGTGGCTGGAGATGG - Intronic
1142661283 17:1431254-1431276 CTGCTGACTCTGGCTGGAGGAGG + Intronic
1142685069 17:1572814-1572836 CTGCCCACTTTGGCTGGGACTGG + Intronic
1142707843 17:1707948-1707970 CTGGTCACCCTGGGTGGAATTGG - Exonic
1142875720 17:2851201-2851223 CTGCACACACTGGCTGGAAATGG + Intronic
1143395469 17:6591866-6591888 TTCCTCACTGTGCCTAGAATGGG - Intronic
1144872381 17:18379182-18379204 CAGCTCTCTGTGGATGGATTGGG + Intronic
1144873589 17:18384834-18384856 CAGCTCTCTGTGGATGGATTGGG + Intronic
1146468837 17:33108442-33108464 CTGATGACTGTGGCAGGGATAGG + Intronic
1146506500 17:33410198-33410220 TTGCCCACTGTTGCTGGAAATGG - Intronic
1147988785 17:44321091-44321113 GCGCTCACTGTGGCTGGGCTGGG - Exonic
1148755500 17:49970992-49971014 CTGCGGAGTGTGGCTGGAGTGGG + Intronic
1149123777 17:53203100-53203122 CTTCTCACTGTGGTTTGAAATGG - Intergenic
1151110102 17:71666332-71666354 TTGCTAAATGTGGATGGAATTGG - Intergenic
1151733209 17:75923090-75923112 CTGCTGACTGAGGCTGCAACAGG + Intronic
1152148705 17:78585347-78585369 TGGCTCACTGCAGCTGGAATGGG - Intergenic
1152926118 17:83088541-83088563 CTGCTCACTGGGGCCTGCATTGG - Intronic
1153156166 18:2151672-2151694 TTGTTCAGTGTGGGTGGAATAGG - Intergenic
1155540510 18:26863956-26863978 CTGCTCATTCTGGCAGGAAATGG + Intronic
1160742047 19:690943-690965 CTGCTCATGATGGCTGGTATCGG + Intronic
1161005479 19:1933711-1933733 CTGCCCTCTGTGGCTGGCCTTGG + Intergenic
1165826505 19:38708867-38708889 TTGCTCACTGTGGCTGGAACGGG - Intronic
1166626253 19:44358815-44358837 CTGCTTTATGGGGCTGGAATGGG + Intronic
1166825437 19:45606189-45606211 CTGCTCACTTTGGCTGGGTTTGG - Intergenic
1168703926 19:58457479-58457501 CTGCTCATTTTTGCTGGATTTGG + Exonic
925156377 2:1651584-1651606 GTGGTCACTGTGGCTGGAAAGGG - Intronic
926210287 2:10864206-10864228 CTGCTCACTTGGGCTGCATTAGG + Intergenic
926212809 2:10883604-10883626 CTGCTGGCTGGGGCTGGAAAGGG + Intergenic
928106662 2:28474920-28474942 TTACCCACTGTGTCTGGAATTGG + Intronic
928543279 2:32303852-32303874 ATGTTCACTAAGGCTGGAATAGG - Intronic
928739099 2:34328709-34328731 CTTCTCACTGTGGCTCTAACAGG + Intergenic
931908352 2:66867723-66867745 CTCCTCACTGTGGCTGCTGTTGG + Intergenic
932744780 2:74324792-74324814 CCAGTCTCTGTGGCTGGAATGGG - Intronic
937749010 2:125451983-125452005 CCTCTCACTGTGGCAGAAATTGG - Intergenic
938097075 2:128471129-128471151 CCGCTCACTGTGGCGGGAGGAGG + Intergenic
938097083 2:128471159-128471181 CCGCTCACTGTGGCGGGAGGAGG + Intergenic
938097091 2:128471189-128471211 CCGCTCACTGTGGCGGGAGGAGG + Intergenic
938097147 2:128471419-128471441 CCGCTCACTGTGGCGGGAGGAGG + Intergenic
938097155 2:128471449-128471471 CCGCTCACTGTGGCGGGAGGAGG + Intergenic
938097193 2:128471581-128471603 CCGCTCACTGTGGCGGGAGGAGG + Intergenic
938097258 2:128471847-128471869 CCGCTCACTGTGGCGGGAGGAGG + Intergenic
938097266 2:128471877-128471899 CCGCTCACTGTGGCGGGAGGAGG + Intergenic
938097273 2:128471907-128471929 CCGCTCACTGTGGCAGGAGGAGG + Intergenic
941732655 2:168935379-168935401 ATCCGCACTGTTGCTGGAATTGG - Exonic
942346318 2:175005742-175005764 AGGCTCACTGTGGCTGGAGCCGG + Intergenic
944254924 2:197615924-197615946 CTGCACACTCTGGCTGAATTCGG - Exonic
945143765 2:206715101-206715123 CTGCTCACTGTGGCTGGAATGGG + Intronic
945607259 2:211950193-211950215 CTGCTCTCTGGGGATGGAACTGG - Intronic
946159332 2:217826562-217826584 CTGAACACTGGGCCTGGAATTGG - Intronic
946159908 2:217829797-217829819 CTGCTCTCTGGGTCTGGAAATGG - Intronic
948007991 2:234626374-234626396 CTGCTCACTTTGGGTTTAATTGG + Intergenic
948102432 2:235385424-235385446 TTGCTCACTGCTGCTGGACTTGG - Intergenic
948739369 2:240032975-240032997 CTGGTCACTGTGGCCAGACTGGG - Intergenic
948782749 2:240333275-240333297 CTGCGCACTGTGTCTGGAATTGG - Intergenic
948799916 2:240428089-240428111 CTGCACACTGCAGCAGGAATCGG + Intergenic
1169270512 20:4195691-4195713 CTTCTCACTGTGGCTGGGCAGGG + Intergenic
1170435857 20:16327881-16327903 GTGCTCTCTGTGGCTGCAGTTGG + Intronic
1170691949 20:18624213-18624235 CTGGGCACTGTGGCTGGACACGG - Intronic
1171406481 20:24915311-24915333 CAGCTCACTGTGGCTGGAGCAGG - Intergenic
1171876101 20:30578336-30578358 CTGCTTTATGGGGCTGGAATGGG - Intergenic
1176300557 21:5097009-5097031 CTGCGCACTGTGGCTGCACCTGG - Intergenic
1176378914 21:6102020-6102042 CTGGTCACTGTGGAGGGAATGGG - Intergenic
1177497122 21:21903775-21903797 CTTCTTTCTGTGTCTGGAATTGG - Intergenic
1177681350 21:24375548-24375570 ATGCTCACTGTGGCTGCTGTGGG + Intergenic
1179744560 21:43436217-43436239 CTGGTCACTGTGGAGGGAATGGG + Intergenic
1179856486 21:44164972-44164994 CTGCGCACTGTGGCTGCACCTGG + Intergenic
1180978861 22:19869274-19869296 CTGCCCGCGGTGGCTGGAATTGG - Intergenic
1181050935 22:20237897-20237919 CTCCTCACTGTGGCTGGAGGCGG + Intergenic
1183493602 22:38129422-38129444 CTGCACTCTGGGGCTGGAGTGGG - Intronic
1183533736 22:38381763-38381785 CTTCTCACTGTAGCAGGTATAGG - Intronic
1184059415 22:42073170-42073192 CTGTTCCCTCTGCCTGGAATTGG + Intergenic
1184261570 22:43320247-43320269 CTGTTCACTGTGGTAGGAACTGG - Intronic
1185063981 22:48621484-48621506 CTGCTCACTCTGGCCGGGGTAGG + Intronic
1185191125 22:49437078-49437100 CTCCTCGCTGTGGCTGCAAACGG - Intronic
950202779 3:11056745-11056767 CTGCTCAGGGTCGCTGGAATGGG + Intergenic
950678484 3:14568957-14568979 CTGCTCACTGGGGCTGTTGTGGG + Intergenic
951114382 3:18843107-18843129 CTTTTCACTGTGGCTGAAAATGG + Intergenic
953526361 3:43692810-43692832 CTGCTGCCTGTCACTGGAATTGG + Intronic
953540335 3:43812518-43812540 CTTCTTACGGTGGCAGGAATGGG + Intergenic
953891860 3:46756758-46756780 CTGCTCAGTGAGGCTGGGAGTGG - Intronic
954302169 3:49705844-49705866 CTGCTGACTGTTGTGGGAATGGG + Intronic
956356504 3:68399152-68399174 CTGCTCAGTATAGCTGGACTTGG - Intronic
956555773 3:70521008-70521030 CAGCTTATTGTGGCTGGAATTGG + Intergenic
956601417 3:71026726-71026748 TTGCCCAGTGTGGCTGGAAAGGG - Intronic
958843189 3:99233384-99233406 CTGCTCTTTGTTGGTGGAATGGG + Intergenic
960122336 3:113959537-113959559 CTTGTGACTGTGGCTGGAAGAGG + Intronic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
963345782 3:144095443-144095465 CTCTTCACTGTGCCTGGAAAGGG + Intergenic
963355038 3:144200707-144200729 CTGCTTCCTGTGGCTGCAGTGGG + Intergenic
973256639 4:48119799-48119821 CTGTTGACTTTGGCAGGAATGGG + Intronic
974174533 4:58307123-58307145 CTGATATCTGTGGCTGGATTGGG - Intergenic
976418841 4:84814069-84814091 CTAATGTCTGTGGCTGGAATGGG + Intronic
977669349 4:99677923-99677945 GAGGTCACTGTGGCTGGAACTGG - Intergenic
977950580 4:102966059-102966081 CTGCTCTCACTGGTTGGAATTGG + Intronic
979227767 4:118309307-118309329 CTCCTCACTGTGACTTGCATGGG + Intronic
981015404 4:139969028-139969050 CTTCCCACTCTGGCTGGGATGGG - Intronic
981797491 4:148613572-148613594 CAGGTCACATTGGCTGGAATGGG - Intergenic
982251703 4:153413732-153413754 GTGCTCACAGTGGCTGCACTGGG - Intronic
982283462 4:153710368-153710390 CTATTCACTAGGGCTGGAATAGG - Exonic
983936216 4:173504413-173504435 CTACCCACTGGGGCTGGGATAGG - Intergenic
986410536 5:7474907-7474929 CTGCCCATTGTGGCTGGCCTGGG - Intronic
987136670 5:14906283-14906305 ATAATCACTCTGGCTGGAATTGG + Intergenic
987370805 5:17191259-17191281 CCTCTCACTGTGGATGTAATTGG + Intronic
989337136 5:40331072-40331094 CTTTTCAGTGTCGCTGGAATGGG - Intergenic
990121699 5:52462404-52462426 CTGCTTCCTGTGTCTGAAATGGG + Intergenic
993352367 5:86866242-86866264 CAGCTCACTTTGACTGGCATTGG - Intergenic
995112215 5:108441270-108441292 TCTCTCACTGTGTCTGGAATTGG + Intergenic
995520892 5:113003947-113003969 CTGCTGACTGTGGCGGAATTTGG - Exonic
995724104 5:115166863-115166885 CTCCTTGCTGTGGCTGGAACAGG - Intronic
997423725 5:133788576-133788598 CTGCTCAGAGAGGCTGGACTTGG - Intergenic
998103733 5:139455322-139455344 GTGCTCACTGTGGCTGCATTTGG - Exonic
998164994 5:139837768-139837790 CTACTCACGGTGCCTGGAAGAGG - Exonic
998935060 5:147226332-147226354 TTGCTCTCTGTGGGTGGAAGTGG - Intergenic
999238068 5:150111698-150111720 CTGGTCAGTGTGGCAGGGATGGG - Intronic
1000415664 5:160981050-160981072 CTTTTCACTGTAGCTGCAATGGG + Intergenic
1000635643 5:163640962-163640984 CTGCAGACTGTGGCTGTAATTGG - Intergenic
1001186034 5:169573782-169573804 TTTCTCACTGTGGCTGGACGAGG - Intergenic
1001766110 5:174248361-174248383 CTCCTTACCTTGGCTGGAATAGG - Intergenic
1002068768 5:176665981-176666003 CTGATCACTGTGCCTGCAAATGG + Intergenic
1002292350 5:178208696-178208718 CTGTCCACTGGGGGTGGAATGGG - Exonic
1002620545 5:180485068-180485090 CTGGGGAGTGTGGCTGGAATAGG + Intergenic
1003525496 6:6893401-6893423 CTTCCCACTGTGGCTTGACTAGG + Intergenic
1003735662 6:8875406-8875428 CTCCTCACTGAGGCTGCAAACGG - Intergenic
1005578535 6:27212068-27212090 CTGTGCACTGTGGCTGCAATGGG + Intergenic
1006061393 6:31422814-31422836 ATGCTCACTGTGGCGGGTAGGGG + Intergenic
1007226166 6:40316369-40316391 CTGATCACTGTGGCTGGAGTTGG + Intergenic
1007828179 6:44617448-44617470 CTCCTCACTGAAGCAGGAATGGG + Intergenic
1011547700 6:88499291-88499313 GAGGCCACTGTGGCTGGAATTGG + Intergenic
1012099887 6:95019417-95019439 ATGCTCACTGTGGTTTTAATTGG + Intergenic
1013490228 6:110639777-110639799 ATGCTCACTGGGGATGGAAGTGG + Intronic
1015683258 6:135831589-135831611 CAGATCATTGTAGCTGGAATGGG + Intergenic
1016695655 6:146991945-146991967 CTTCTCACTGTTGCTGGTCTTGG - Intergenic
1016858614 6:148696286-148696308 CTTCACACTGTGTCCGGAATTGG + Intergenic
1017848151 6:158277615-158277637 CTGCTCAGTGTGGCTCGTGTAGG + Intronic
1018689396 6:166332773-166332795 GTGCTTACTGTGGCGGGAATAGG - Intronic
1019146899 6:169981424-169981446 CTGCTCACTGAGGCTGGAGGGGG + Intergenic
1021645107 7:22782158-22782180 CTCCGAACTGTGGCTGGAATTGG - Intergenic
1021869302 7:24987776-24987798 CTGCTCACTGGGCCTGGAATGGG - Intergenic
1022120182 7:27300569-27300591 CTTCTCACTGTGGCTTGGTTAGG + Intergenic
1022577382 7:31511114-31511136 CAGCTCAGTGTGGCTGGATGAGG + Intergenic
1024252874 7:47519667-47519689 CAGCTCACTGTGGCTAGCATGGG - Intronic
1026442507 7:70456705-70456727 CCACTCACTGTGGCTGGAAGGGG + Intronic
1029596658 7:101541273-101541295 CTGAACTCTCTGGCTGGAATTGG + Intronic
1032350440 7:131158051-131158073 CTGTTTACTGTGCCTGGAAACGG + Intronic
1034062809 7:148108544-148108566 CTGCTCCCCGTGGTTGGAACTGG + Intronic
1034315355 7:150125969-150125991 CTGCTCTCTCTGGCTGAACTGGG + Intergenic
1034791539 7:153974825-153974847 CTGCTCTCTCTGGCTGAACTGGG - Intronic
1035682726 8:1500257-1500279 CCACTCACTGTGGCTGGTGTCGG + Intergenic
1036491131 8:9226509-9226531 CTGCCCAGTGTGGCTAAAATTGG - Intergenic
1037924275 8:22832364-22832386 CTTCTCACTGTGGGTGCACTTGG - Intronic
1042903961 8:73754587-73754609 CTCCCCACTGTGGCTGCAATTGG - Intronic
1045403981 8:101846906-101846928 ATACTCCTTGTGGCTGGAATGGG - Intronic
1047253292 8:123196866-123196888 CTGCTCACTCTGGCTTTCATGGG + Intronic
1049801893 8:144521729-144521751 CTGCTCAGTTTGGCTGCATTTGG + Exonic
1051225954 9:14899363-14899385 CTGCTCACTTTGGCAGAATTTGG + Intronic
1058439345 9:104992706-104992728 CTGCTCACAGTTGCTGAATTTGG + Intergenic
1059334023 9:113557425-113557447 CTGTCCTCAGTGGCTGGAATGGG - Intronic
1060092695 9:120758180-120758202 ATGCTCAGTGAGGCTGGAGTGGG + Exonic
1060246104 9:121947627-121947649 ATGCTCTCTGTGGCTGAGATAGG - Intronic
1061340463 9:129976348-129976370 CTGATAAATGTGGCTGGAGTAGG + Intronic
1062020364 9:134316437-134316459 CTGGTCACTGTGGCAGCCATAGG + Intergenic
1062192280 9:135254173-135254195 CTGCTCACACTAGCTGGAAAAGG - Intergenic
1189777710 X:44485091-44485113 CTACTTACTGTTGCTGGAAAGGG + Intergenic
1192251583 X:69418040-69418062 CATCACACTGTGTCTGGAATTGG - Intergenic
1198183202 X:134230101-134230123 CACCTCAATGTGCCTGGAATTGG - Intergenic
1198663168 X:138993460-138993482 CTGTTCACTTTGGATGAAATAGG - Intronic
1200012017 X:153126684-153126706 CTGCTCAGAGTGCCTGGAGTAGG + Intergenic
1200027583 X:153273235-153273257 CTGCTCAGAGTGCCTGGAGTAGG - Intergenic
1200078340 X:153563055-153563077 GTGCCCAGTGTGGCTGGATTTGG - Intronic