ID: 945144214

View in Genome Browser
Species Human (GRCh38)
Location 2:206719631-206719653
Sequence TGTGGATGGTCCACTGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 2, 2: 10, 3: 62, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945144214 Original CRISPR TGTGGATGGTCCACTGCTGT GGG (reversed) Intergenic
900672680 1:3865627-3865649 TGTGCGTGGTCCCCAGCTGTTGG + Intronic
900944468 1:5822109-5822131 GGTGGCTGGGCCACTGCAGTAGG - Intergenic
902321861 1:15673494-15673516 TGTGAATGGTCTGCTGCTGCAGG + Intergenic
905573247 1:39022997-39023019 TGTGGATGGTCTGCCACTGTGGG - Intergenic
906364774 1:45198007-45198029 TGTGGATGGTCTGCTGCTGCAGG - Intronic
907369247 1:53989325-53989347 TGTGGATGGTCTGCCACTGTGGG - Intergenic
908072759 1:60481556-60481578 TGTGGATAGTCTGCTGCTATGGG + Intergenic
908807740 1:67948424-67948446 AGTGGATGGTCCACTGATGCAGG - Intergenic
909198854 1:72663028-72663050 TGTGGATGGCCTGCTGCTGTGGG - Intergenic
911468887 1:98291268-98291290 TGTGGATGGTCTATTGTTGTGGG - Intergenic
911550786 1:99277504-99277526 TGTGGATGGTCTGATGTTGTGGG + Intronic
912408054 1:109458396-109458418 TGTGGATGTCCTGCTGCTGTGGG + Intergenic
914267128 1:146047849-146047871 TGTGAATGGACCCCTGCTCTAGG + Intergenic
918442379 1:184580539-184580561 TGTGGATGGTCTGCCCCTGTGGG + Intronic
919064913 1:192682596-192682618 TGTGGCTGGACCACTGCAATAGG + Intergenic
920707250 1:208262189-208262211 TGTGGATAGTCTGCTGCTGTAGG + Intergenic
921958128 1:221005122-221005144 TGTGGATGGTCTGCCACTGTGGG - Intergenic
922030913 1:221797061-221797083 TGTGGATGGTCTGCTGCTATGGG + Intergenic
923926510 1:238634758-238634780 TGTGGATGGTCTGCCACTGTGGG - Intergenic
924246588 1:242091519-242091541 TCTGGACTTTCCACTGCTGTAGG - Intronic
924642642 1:245848784-245848806 TGGGGTTGGTCCACAGCTGTGGG + Intronic
1062895152 10:1097607-1097629 TGCCCATGGTCCAGTGCTGTGGG + Intronic
1065919393 10:30378845-30378867 TGTGGATGGTGAAGTGCTGATGG + Intergenic
1066012411 10:31207000-31207022 TGTGGCTGGTACACTGGGGTAGG + Intergenic
1067751962 10:48977604-48977626 TCTGGCTGGCCCACTGATGTGGG - Intronic
1067755922 10:49005029-49005051 CGTGGATGGTCTCCTGCTGCAGG - Intergenic
1068107835 10:52642009-52642031 TGTGGATGGTCTGCTGCTGTGGG - Intergenic
1068562618 10:58532588-58532610 TGTGGATGGTCTGCTGCCATGGG - Intronic
1068919585 10:62468683-62468705 TGTGGATGGTCTGCCGCTGAAGG - Intronic
1069309466 10:67016425-67016447 AGTAGGTGGTACACTGCTGTAGG - Intronic
1069351013 10:67527375-67527397 TGTGGATGGTCTGCTGCTGTGGG - Intronic
1070753552 10:78977716-78977738 TGTGGTTCCCCCACTGCTGTGGG + Intergenic
1070978073 10:80621713-80621735 TGCTGATGGTCCACAGCTGGTGG + Intronic
1072304930 10:94097938-94097960 TGTCGCCTGTCCACTGCTGTAGG - Intronic
1075628650 10:123985569-123985591 TGTGGATGATCTGCTGCTGTTGG - Intergenic
1079595077 11:22234272-22234294 TGTGCATGGTCTGCTGCTGTAGG + Intronic
1080844877 11:36018090-36018112 TGTGGATGGTCTGCGGCTGCAGG + Intronic
1081657310 11:44865984-44866006 TGTGGATGGCCACCTGCTGGGGG + Intronic
1082881849 11:58045740-58045762 TGTGGATGACCCAGTTCTGTTGG - Intronic
1083085543 11:60140080-60140102 TATGGATGGTCTGCTGCTGCCGG + Intergenic
1085140771 11:74139610-74139632 AGTGGTTGATCTACTGCTGTTGG + Exonic
1088187462 11:107187702-107187724 TGTGGATGGTCAGCTACTATGGG - Intergenic
1091853094 12:3716590-3716612 TGTGGATGGTCTGCTGCTATGGG + Intronic
1092088855 12:5787428-5787450 TGTGTATGCCCCACTGCTGGGGG - Intronic
1092120966 12:6043639-6043661 TGTGGATGTTCTGCTGCTGGTGG - Intronic
1094675304 12:32614009-32614031 TGTGGATGGTCTGCTGCTGCAGG - Intronic
1095275568 12:40278676-40278698 TGTGGATGGCACACTTTTGTCGG + Intronic
1096867711 12:54575163-54575185 AGTGGTTGGTCCACAGCCGTTGG + Exonic
1099443079 12:82722011-82722033 TGTGGATGTTTCACTTTTGTTGG + Intronic
1099541671 12:83917372-83917394 TGTGGATGATCTGCTGCTATGGG + Intergenic
1099541684 12:83917552-83917574 TGTGGATGGTCTGCTGCTATGGG + Intergenic
1100184060 12:92119098-92119120 TGTGGATAGTCTGCTGCTGTGGG - Intronic
1100282638 12:93132829-93132851 TGCGAATGGTCTGCTGCTGTGGG - Intergenic
1102270372 12:111529544-111529566 TGTTGAGAGCCCACTGCTGTGGG - Intronic
1103391325 12:120575690-120575712 TGAGGATGGTCCACTGGTGAAGG + Intronic
1103447612 12:121004407-121004429 TGTGGATGGCTGACTCCTGTAGG + Exonic
1104098684 12:125585404-125585426 TATGGATGATGAACTGCTGTTGG + Intronic
1104983606 12:132584740-132584762 TGTGGATGGTGCAGTGTTCTTGG + Exonic
1106677324 13:31974811-31974833 TGTGGATGGTCTGCTGTTGTAGG - Intergenic
1106697242 13:32189029-32189051 TATGGATGGTCTACCACTGTGGG + Intronic
1107043513 13:35973038-35973060 CGTGGAAGCTCCTCTGCTGTGGG - Intronic
1108206877 13:48099038-48099060 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
1109570477 13:64182363-64182385 GGTGGATGGTATGCTGCTGTAGG - Intergenic
1111903199 13:94225215-94225237 TGTGGATGGTCTGCTACTGAGGG + Intronic
1113016398 13:105832988-105833010 TGAGGACAGTCCACTGCTCTTGG + Intergenic
1113529291 13:111008938-111008960 TGTAGATGGTCTACTGCAGAGGG + Intergenic
1114357306 14:21925417-21925439 TGTGGATGGTCTACCACTGCAGG - Intergenic
1114485362 14:23058367-23058389 TGAGGAAGGTCCACAGCTTTGGG + Intergenic
1116268087 14:42721708-42721730 TGTGGATGGTCTGCCCCTGTGGG + Intergenic
1116327159 14:43544730-43544752 TGTGGATGGTCTGCCTCTGTGGG - Intergenic
1118159970 14:63278328-63278350 TAAGTATGGTCCACTCCTGTTGG - Intronic
1118830653 14:69428380-69428402 TGTGGATGGTCTGCTGCTGCAGG - Intronic
1119987828 14:79159552-79159574 AGTGGATGGTCTGCTGCTGTAGG + Intronic
1120847847 14:89141753-89141775 TGTGGATGGTCTGCTGCTGCAGG + Intronic
1129086290 15:73096122-73096144 TGTAGATGATCTGCTGCTGTGGG - Intronic
1129223112 15:74145981-74146003 CATGGATGGTCTGCTGCTGTGGG - Intergenic
1130074440 15:80676544-80676566 TGTGAATGGACCCCTGCTCTTGG + Intergenic
1130127936 15:81109825-81109847 TGTGGATGGTCTACCACTGCAGG + Intronic
1131391194 15:92050239-92050261 TGTGGATAGTGCACCTCTGTGGG + Intronic
1131430239 15:92381828-92381850 TGTGGATGATCTGCTGCTGCAGG + Intergenic
1133039632 16:3053546-3053568 TGTGCATTGTCAGCTGCTGTCGG + Intronic
1133043479 16:3073179-3073201 TGTGCATTGTCAGCTGCTGTCGG + Intronic
1133722166 16:8504913-8504935 TGTGGATGGTCTGCCACTGTGGG + Intergenic
1136667560 16:31825803-31825825 TGTGGATGGTCCTCTTGTATAGG - Intergenic
1137903812 16:52298582-52298604 TGTGGATGGTCTGCTGCTGTGGG - Intergenic
1138771522 16:59670286-59670308 TGTTGATGGTCTGCTGCTGTGGG - Intergenic
1139114345 16:63931295-63931317 TGTAGATGGTCTGCTGCTGCAGG - Intergenic
1141914341 16:87084316-87084338 TGTGGATGGTCTGATGCTGTGGG - Intronic
1143676003 17:8433367-8433389 TGTGGAGGGTCTGCTGCTGTGGG + Intronic
1146210779 17:30941307-30941329 TGTAGATGGTCTGCTGCTGCAGG + Intronic
1146480480 17:33201239-33201261 TGTGGATCGAGCACTGCTGTAGG - Intronic
1150891921 17:69161941-69161963 TGTGGATGGTCTGCTGCTATAGG - Intronic
1156888426 18:42162576-42162598 TGTGGGTGGTCTGCTGCTGCAGG + Intergenic
1157098119 18:44705727-44705749 TATACATGGTCCACTGCTTTGGG + Intronic
1157575053 18:48738159-48738181 TGCTGATGGTCCACTGCGGGTGG - Intronic
1160848414 19:1177465-1177487 TGTGGATGGTCCAGTGTGGGAGG - Intergenic
1161697778 19:5779357-5779379 TATGGATGGGCCAGTGCTCTAGG + Intergenic
1166393189 19:42421602-42421624 TGTGGACGCACAACTGCTGTGGG - Intronic
1167004211 19:46765089-46765111 TTTGAATTGTTCACTGCTGTAGG - Intronic
925764899 2:7223053-7223075 TGGGGATGGTCTACTGCTATGGG + Intergenic
926410774 2:12600168-12600190 TGTGTATGGTCTGCTGCTGTGGG - Intergenic
929666432 2:43837897-43837919 TCTGCCTGGTCCACTGCTGCCGG + Exonic
929816204 2:45234079-45234101 TGTGGATGGTCTGCTGCAGTGGG + Intergenic
930081821 2:47456397-47456419 TGTGGATGGTCTGCCGCTGTGGG + Intronic
930095224 2:47561504-47561526 TGTGCATGGTCCAGTCCTCTGGG - Intronic
931921198 2:67017603-67017625 TATTGATGGACCAGTGCTGTTGG + Intergenic
935281770 2:101524117-101524139 TGTGGATGGTCTGCTGCTGTGGG + Intergenic
935286843 2:101572402-101572424 TGTGTATCGTCTGCTGCTGTGGG - Intergenic
935612730 2:105042484-105042506 TGTGGGTCTTCCACTGTTGTAGG - Intronic
935801908 2:106706194-106706216 TGTGGATGGTCTGCTGGTGTGGG + Intergenic
936470984 2:112798318-112798340 CGTGGATGAACCACAGCTGTCGG - Intergenic
936494220 2:113004003-113004025 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
937439267 2:121902942-121902964 CGTGGATGGAGCACTGCCGTGGG + Intergenic
937453866 2:122024916-122024938 TGTGGAGGCTAAACTGCTGTGGG + Intergenic
938241425 2:129745054-129745076 TGTGACTGGGCCACTGCGGTGGG + Intergenic
938784653 2:134615439-134615461 TGTGGATGGTCTGCTGCTATGGG - Intronic
941004493 2:160234084-160234106 TGTGGATGGTCTGCTGCCATGGG - Intronic
941619384 2:167759000-167759022 TCTGGATGGCCAACTGGTGTTGG + Intergenic
941634284 2:167918612-167918634 TGTGGATGGTCTGCTGCTGCAGG - Intergenic
942365999 2:175228445-175228467 TGTGGATGCTGCACTGCTTATGG - Intergenic
942367822 2:175247112-175247134 TGTGGATGGTCTGCCACTGTGGG - Intergenic
942844182 2:180403295-180403317 TGTGGGTGGTCTGTTGCTGTGGG - Intergenic
943633034 2:190275731-190275753 TGTGGATGGTCTGCCACTGTGGG - Intronic
943667901 2:190629618-190629640 CGTGGATGGTCTGCTGCTCTAGG - Intergenic
944783221 2:203041231-203041253 TGGGCTTGGTCCATTGCTGTGGG - Intronic
945144214 2:206719631-206719653 TGTGGATGGTCCACTGCTGTGGG - Intergenic
947887681 2:233587484-233587506 TATGGATGGTCTGCTGGTGTGGG + Intergenic
947893899 2:233650511-233650533 TATGGATGGTCTGCTGGTGTAGG + Intronic
948594645 2:239071956-239071978 TGTGGATGGTCTGCAGCTGGGGG + Intronic
1168744217 20:222963-222985 TGTGGGTGGTCTGCTGCTGGTGG - Intergenic
1170174687 20:13455648-13455670 TGTGGATGGTCTGCTGCTGCAGG - Intronic
1173794075 20:45846685-45846707 TGTGAATGCTCACCTGCTGTGGG - Intronic
1173944978 20:46943271-46943293 AGTGGATGGTCCTTTGTTGTTGG - Intronic
1174884891 20:54322759-54322781 GGTGGATGGTCTACTGCTACGGG + Intergenic
1176713275 21:10326868-10326890 TGTTGATAGTCCACTGTTGATGG + Intergenic
1178189967 21:30268940-30268962 TATGGAGGGGGCACTGCTGTTGG - Intergenic
1180093715 21:45544787-45544809 TGGGGATGGGGCACTGCTGTGGG - Intergenic
1180204081 21:46246541-46246563 TGAGGATGGTCCAGTAGTGTTGG - Intronic
1182049802 22:27303963-27303985 TGTGGAGGGGGCACTGATGTGGG + Intergenic
1184628300 22:45755174-45755196 TCTGAATGGGCCACTGCTGCAGG - Intronic
1185308144 22:50134599-50134621 GGTGGACTGTCCACTGCTTTTGG - Exonic
950006971 3:9697706-9697728 AGGGGATGGTCCACTGATCTGGG - Exonic
950829897 3:15862995-15863017 TGTGGATGGTCTGCCACTGTGGG + Intergenic
951297422 3:20955785-20955807 TGTGGATGGTCTGCTATTGTGGG - Intergenic
952203270 3:31152506-31152528 TGTGGATGCTCACCTGATGTTGG + Intergenic
952389411 3:32866809-32866831 TGTGGTTGGTTGGCTGCTGTTGG + Intronic
952523579 3:34186446-34186468 TGTGGCTGGCCCAAGGCTGTAGG + Intergenic
956091308 3:65669925-65669947 TGTGGATGGTCTGCCACTGTGGG + Intronic
956486387 3:69726568-69726590 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
956923582 3:73957334-73957356 TGTGGATGGTCTGCTGCTGTGGG - Intergenic
959739391 3:109698762-109698784 TGTGGATGGTCTGCTGCTGTGGG + Intergenic
959959549 3:112281944-112281966 TGTGGATGATCCGCCACTGTGGG - Intronic
960097838 3:113704967-113704989 TGTGGATGGTCTGCAGCTATGGG + Intergenic
960899048 3:122535794-122535816 TGAGGACGGTTCAGTGCTGTTGG + Intronic
961082982 3:124042411-124042433 TGTGGAGGGTCCATTGGAGTAGG + Intergenic
961121085 3:124370906-124370928 TGTGGATGGTCTGCTGCTGCGGG + Intronic
961969659 3:130947224-130947246 GGTGGATGGACCAGTGCTTTTGG - Intronic
962646202 3:137443298-137443320 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
962823891 3:139081297-139081319 TGGGCTTGGTCCACTGCTGCAGG + Intronic
964420553 3:156498230-156498252 TGTGGATGGTTTGCTGCTGTGGG - Intronic
964954863 3:162340954-162340976 TGTGGATGGTCTGCCACTGTGGG + Intergenic
965056969 3:163732040-163732062 AGTGGATGGTCCAGAGCTGATGG - Intergenic
967014790 3:185472151-185472173 TGTGGTTGGTCTGCTCCTGTGGG + Intronic
971958163 4:33450442-33450464 TGTAGATGGTCTATTGGTGTGGG - Intergenic
972313758 4:37906093-37906115 TCTGGATGGTCTGCTGCTGCAGG + Intronic
976528610 4:86122765-86122787 TGTGGATGGTCTGCCTCTGTGGG + Intronic
977156903 4:93585481-93585503 TGTGGATGGTCTGCTGCTGAGGG + Intronic
978322077 4:107508336-107508358 TCTGAATGGACCACTGCTCTGGG + Intergenic
978555989 4:109980950-109980972 TCTGGATGGTCATCAGCTGTTGG + Exonic
980590494 4:134881587-134881609 TGTAGATGATCAGCTGCTGTGGG - Intergenic
983167155 4:164491851-164491873 TGTGGATGGTCTGCTGCTACAGG + Intergenic
984052475 4:174882699-174882721 TATGGATGGTCTGCTGCTGCAGG - Intronic
984061780 4:174997671-174997693 TGTGGATGGTCTGCTGCTGTGGG + Intergenic
984891628 4:184498971-184498993 TGTGAATGGTCTGCTGCTGTGGG - Intergenic
985478770 5:94299-94321 TGTGGACAGGCCAGTGCTGTTGG + Intergenic
986119996 5:4826262-4826284 TGTGGATTGTCTGCTTCTGTTGG + Intergenic
986251893 5:6067538-6067560 TGTGGGTGGTCTGCTGCTGTGGG - Intergenic
987029501 5:13962949-13962971 GGTGGATGCACCGCTGCTGTGGG - Intergenic
987225063 5:15831519-15831541 TTTCTATGGTCCAGTGCTGTGGG + Intronic
988608743 5:32705270-32705292 TGTGGATGGTCTGCCACTGTGGG - Intronic
988935064 5:36073693-36073715 TGTAGATGGTTTCCTGCTGTGGG + Intergenic
989141425 5:38205335-38205357 TGTGAATGGTCTGGTGCTGTGGG - Intergenic
993625302 5:90216918-90216940 TGTGGATGGTCTGCCGCTGAAGG + Intergenic
994226789 5:97261692-97261714 TGTGGATGGTCTACTGCTGTGGG - Intergenic
994940271 5:106314733-106314755 TGTGGATGTTCTGCTGCTGTGGG + Intergenic
996756593 5:126942504-126942526 TTTAGATGGTCAACTCCTGTAGG - Intronic
997496464 5:134331242-134331264 TGTGAATGGTCTGCTGCTGCAGG + Intronic
998346242 5:141466532-141466554 TGTAGATGGTCTTTTGCTGTGGG + Intronic
998577718 5:143334597-143334619 TGGGCTTGGTCGACTGCTGTAGG - Intronic
998835490 5:146199204-146199226 TGTGGATGATCTGCAGCTGTGGG - Intergenic
998928282 5:147152248-147152270 TGTGGACAGTCTGCTGCTGTGGG - Intergenic
1000490139 5:161902774-161902796 TGTAGATGGTTTGCTGCTGTGGG + Intergenic
1002983923 6:2169762-2169784 TGAGGATGGTGTTCTGCTGTAGG - Intronic
1005002023 6:21251080-21251102 TATGGATGGTCTTCTGCTGTTGG + Intergenic
1005319306 6:24636711-24636733 TGTGGATGATCTGCTGCTGTGGG - Intronic
1006529819 6:34642209-34642231 TGTGGATGGTCCGCTGCTATGGG - Intronic
1007889518 6:45273259-45273281 TGTGGATGGTCCGCTGCTGTGGG + Intronic
1011533256 6:88348091-88348113 TGTGGATGGTCTGCTGCTATGGG + Intergenic
1012020324 6:93909706-93909728 TGTGGATGGTCTGCTTCTGTGGG + Intergenic
1013540848 6:111107511-111107533 CACGGATGGTCTACTGCTGTGGG - Intronic
1014145055 6:117987969-117987991 TATGAATGGCCCACCGCTGTTGG - Intronic
1015900482 6:138060314-138060336 GGTGGATGGTCTGCCGCTGTGGG - Intergenic
1016301936 6:142642278-142642300 TGTGGATGGTCTGCCACTGTGGG - Intergenic
1016588092 6:145712203-145712225 TGTGGATGGTCTGTTGCTGCAGG - Intronic
1016787648 6:148030190-148030212 TGTGTATGGTCTGTTGCTGTGGG - Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017343343 6:153352436-153352458 TGTGGATAGTCTGCTGCTATGGG - Intergenic
1017926397 6:158914868-158914890 TGTGGGTGGACCACTGCTGCAGG + Intergenic
1018257428 6:161935795-161935817 TGTGGATGGTCTATTGCTGCAGG - Intronic
1018637537 6:165876910-165876932 TGTGGATGGTGCATTTCAGTCGG - Intronic
1020508857 7:9027091-9027113 TTTGCATGATCCACTGCTGTGGG - Intergenic
1020960456 7:14796218-14796240 TGTGTATGGTCCTCTACTGTGGG - Intronic
1022468393 7:30666455-30666477 TGTTGATTCTCCACTGCTGGAGG + Intronic
1022513484 7:30959326-30959348 TGTGGATGGTCTGCTGCTACAGG - Intronic
1025615543 7:63113782-63113804 TGAGGATGGTCTGCTGCTGCCGG + Intergenic
1026866160 7:73825233-73825255 GGTGGATGGTCCGCTGGTGTGGG + Intronic
1027376113 7:77551571-77551593 TGTGGATGGTCTGCTGCTACAGG + Intronic
1029952159 7:104598120-104598142 TGTGGATGCTCTGCTGCTGTGGG - Intronic
1030547435 7:110914466-110914488 TGTGGATGGTCTGCTGCTGTGGG + Intronic
1030659932 7:112207364-112207386 TGTAGATGGTTAACTGCTCTGGG + Intronic
1031769331 7:125823363-125823385 TGTGGATAGTCTGCTGCTGCAGG - Intergenic
1032022192 7:128414058-128414080 TGTAGATGGTCTGCTGCTTTGGG + Intergenic
1032625725 7:133589752-133589774 TGGGGATGGTCTGCTGCCGTAGG + Intronic
1034877648 7:154739433-154739455 TCTGGTTGGGACACTGCTGTGGG + Intronic
1037661580 8:20932220-20932242 TGAGGATGGTCTGCTGCTGCTGG + Intergenic
1041147745 8:54895748-54895770 TATGGATGGCCAGCTGCTGTGGG - Intergenic
1041160791 8:55041551-55041573 TGTGGCTGGTCTGCTGCTGTAGG + Intergenic
1041377114 8:57216120-57216142 GGTGGGAGGTTCACTGCTGTAGG - Intergenic
1041589647 8:59562502-59562524 TGTGGATGGTCTGCTAGTGTGGG - Intergenic
1041991416 8:63996758-63996780 TGCGGATGGTCTGCTGCTGCAGG - Intergenic
1045391726 8:101721802-101721824 TGAGTATGGCCAACTGCTGTAGG + Intronic
1045631941 8:104134697-104134719 TGTGGATGGTCTACCACTGGGGG + Intronic
1045916682 8:107480536-107480558 TGTGGATAGTCTGCTGCTGCAGG - Intronic
1050673263 9:8022481-8022503 TGTGGATAGTCTGCTGCTGTGGG - Intergenic
1050713751 9:8496356-8496378 AATGCATGGTCCACTGCTGTAGG + Intronic
1051529322 9:18082662-18082684 TCTGGATGGTCTCCTGCCGTAGG + Intergenic
1052997567 9:34559390-34559412 GGTGGAGGGTGCAATGCTGTGGG + Intronic
1055034821 9:71807191-71807213 TCTGGATGGTGAACTGCTGAGGG - Intronic
1055119700 9:72645091-72645113 TGTGGATGGTCTGCTGCTGTGGG - Intronic
1055168818 9:73229377-73229399 TGTAGATGGTCTGCTGCTGCAGG - Intergenic
1055605280 9:77963236-77963258 TGTGGATGGTCTGCTGTTGTGGG - Intronic
1056419746 9:86412408-86412430 TGTGGATAGTCTGCTGCTGCAGG - Intergenic
1058199307 9:102019025-102019047 TGTGGATGGTCCTCTCCTATTGG + Intergenic
1058644709 9:107119929-107119951 TCTGGAAGGGCCACTACTGTGGG - Intergenic
1060603600 9:124895038-124895060 TGTGGATGGTTCTTTGTTGTGGG - Intronic
1060603734 9:124895896-124895918 TGTGGATGGTTCTCTGTTGTGGG - Intronic
1203624746 Un_KI270750v1:3775-3797 TGTGGATGGTCTGACGCTGTGGG + Intergenic
1186628667 X:11323922-11323944 TATGGATGGCCTGCTGCTGTGGG - Intronic
1189637354 X:43024839-43024861 TGTGGATGGTTTGCTGCTGCAGG + Intergenic
1194931758 X:99896854-99896876 TGTGGATGGTCTGCTGCTGCAGG + Intergenic
1196239439 X:113324724-113324746 TGCGGATGGTCTGCTGCTGTGGG + Intergenic
1197109189 X:122752990-122753012 TGTGGATGGTCTGTGGCTGTAGG - Intergenic
1197495076 X:127170032-127170054 TATGGATGGTCAGCTGCTGTGGG - Intergenic
1198457742 X:136833900-136833922 TGTGGATGGTCTGCCACTGTGGG + Intergenic
1199369058 X:147023308-147023330 TGTGGAGGGTCTGCTGCTGTGGG + Intergenic
1199938583 X:152601822-152601844 TGAGGAGGGACCACTGCTGCTGG - Intergenic
1201718497 Y:17072640-17072662 TGTGTCTGGTCCAGTGCAGTGGG + Intergenic
1201984969 Y:19956290-19956312 TGTGGATGGTCGGCTGCTAGAGG + Intergenic