ID: 945146116

View in Genome Browser
Species Human (GRCh38)
Location 2:206739935-206739957
Sequence CCCTGGCCCCCATAAACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945146110_945146116 -6 Left 945146110 2:206739918-206739940 CCCTATGAAGCCTCCTTCCCTGG 0: 1
1: 0
2: 4
3: 49
4: 336
Right 945146116 2:206739935-206739957 CCCTGGCCCCCATAAACCACTGG 0: 1
1: 0
2: 2
3: 21
4: 164
945146109_945146116 1 Left 945146109 2:206739911-206739933 CCAACATCCCTATGAAGCCTCCT 0: 1
1: 0
2: 1
3: 13
4: 185
Right 945146116 2:206739935-206739957 CCCTGGCCCCCATAAACCACTGG 0: 1
1: 0
2: 2
3: 21
4: 164
945146112_945146116 -7 Left 945146112 2:206739919-206739941 CCTATGAAGCCTCCTTCCCTGGC 0: 1
1: 0
2: 9
3: 35
4: 280
Right 945146116 2:206739935-206739957 CCCTGGCCCCCATAAACCACTGG 0: 1
1: 0
2: 2
3: 21
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945146116 Original CRISPR CCCTGGCCCCCATAAACCAC TGG Intronic
900329912 1:2128891-2128913 CCCTGGCCCCCAGATACTACCGG - Intronic
900426723 1:2583779-2583801 CCCTTGCCCCCAAATTCCACGGG - Intergenic
900551822 1:3260207-3260229 GCCTGGCCCCCCAGAACCACAGG - Intronic
902568474 1:17331323-17331345 CCCTGACCTCCATGAACCCCTGG - Intronic
903138715 1:21326053-21326075 CCCTGGTCCCCACACCCCACTGG - Intronic
903472176 1:23594952-23594974 CCCTGGCCCCAGCAAGCCACAGG + Intronic
903567244 1:24277383-24277405 CACTGCCCCCCAAAAACCAGGGG + Intergenic
904609674 1:31718573-31718595 CCCCATCCCCCATCAACCACTGG + Intergenic
906484192 1:46221868-46221890 CCCTGGCTCCCATCAACAAAGGG - Intergenic
906511746 1:46413971-46413993 CCCTGGTGCCCATCACCCACAGG + Intergenic
906970396 1:50507487-50507509 CTTTGGCCCCCAAAAAACACTGG - Intronic
910218473 1:84865566-84865588 CCCTGGCCCCCATTTACAGCAGG - Exonic
911150984 1:94596647-94596669 CCCTTGCCCCAACAAACCAGGGG + Intergenic
912419358 1:109532692-109532714 CCCGGGCGCCCAGAAACCCCAGG + Intergenic
922436483 1:225612411-225612433 CCCTGTTCCCCATCAACCCCTGG - Intronic
922561438 1:226572584-226572606 CCCTGGCCTGCTTAATCCACCGG - Intronic
1065013003 10:21436423-21436445 GCCTGGCCCCCCTGAGCCACAGG - Intergenic
1072810058 10:98454555-98454577 CCCTGGCCCCCATGACCCAAAGG - Intergenic
1076299141 10:129411561-129411583 CCCTGGCACCCAGAATGCACTGG + Intergenic
1077914278 11:6601132-6601154 CCCTGACCCCCATTCACCGCTGG + Exonic
1078369036 11:10729950-10729972 CCTTGGCCCCCCTAAAGCACTGG + Intergenic
1081695614 11:45107107-45107129 CCCTGGGCCCCCTAAACACCAGG - Intronic
1083946300 11:65924914-65924936 TCCTGCCTCCCATCAACCACGGG - Intergenic
1084268819 11:68018579-68018601 CCCTGGCCCTCAGGAACCTCCGG + Exonic
1089631535 11:119787459-119787481 CCCTAGCCCCCACCAGCCACTGG + Intergenic
1090725400 11:129521235-129521257 CTCTGGCCCCCAAATCCCACGGG + Intergenic
1091949507 12:4581160-4581182 CCCTGACCCCCAGCAAGCACAGG - Intronic
1094265275 12:28551706-28551728 CCCAGTCCCCCATAATCCACAGG + Intronic
1094303724 12:28994780-28994802 CCCTTGCAGCCATAAACCCCAGG - Intergenic
1094499207 12:31007661-31007683 CCCTGGCCCACAGAAAGCATCGG - Intergenic
1103486798 12:121288573-121288595 CCCTGGCCCCCGCAAAACACTGG + Intronic
1106025395 13:25950944-25950966 CCCTTTCCCCCATGAGCCACTGG + Intronic
1106795028 13:33196499-33196521 CCCTCCCTCCCAGAAACCACTGG - Intronic
1107430838 13:40338704-40338726 CCTTGGCTCCCAGAAACCGCAGG - Intergenic
1111973720 13:94944216-94944238 CATTGGCCCCCTTAAATCACAGG - Intergenic
1113711156 13:112466443-112466465 TCCTGGCCCCCCTAAAGCACGGG + Intergenic
1113949791 13:114065628-114065650 CCCTGGCTCCCACAGACCGCAGG + Intronic
1116019205 14:39441062-39441084 CCCTGGGCCCCAGAGAGCACAGG - Intergenic
1116800425 14:49437931-49437953 CCCTGGCCAACAGTAACCACAGG + Intergenic
1119761526 14:77155291-77155313 ACGTGACCCCCTTAAACCACAGG - Intronic
1119890797 14:78180730-78180752 TCCTGGGCCCCATAAATCCCAGG + Intergenic
1122218966 14:100223003-100223025 CCCCGGTCCCCTTGAACCACAGG - Intergenic
1122248917 14:100424571-100424593 CCCTGGGCCCCAGACTCCACAGG - Intronic
1122700338 14:103584146-103584168 CCCTCGGCCCCACAAAGCACTGG + Intronic
1123429313 15:20201384-20201406 CCCTGGCCCCCAGCCACCACTGG - Intergenic
1125540304 15:40466275-40466297 CCCTGGAGCCCAGAACCCACAGG - Exonic
1126566617 15:50108009-50108031 ACCTGGCCCCTAGAAAACACTGG - Intronic
1126868251 15:52959605-52959627 CCCTGCCCTCCATAATGCACAGG + Intergenic
1128536104 15:68491833-68491855 CCCTGGCCCCCACAGGACACAGG - Intergenic
1128545239 15:68562042-68562064 CCCTGGGCCCCAGTACCCACTGG - Intergenic
1129238626 15:74238971-74238993 CCCTGGCCGCCATAACTCTCAGG + Intronic
1129324169 15:74790821-74790843 CCCAGTCCACCCTAAACCACAGG + Intronic
1131605790 15:93901143-93901165 TCCTGGCCCCCCGAAAGCACAGG + Intergenic
1132542862 16:519434-519456 CCCTGACTCCCATGAACCAGAGG + Intronic
1135621199 16:23957535-23957557 CACTGGCCCCCAGTAAACACTGG - Intronic
1136855005 16:33648348-33648370 CCCTGGCCCCCAGCCACCACTGG + Intergenic
1139572291 16:67820872-67820894 CCATGGCCCACATACACCAGTGG + Exonic
1142015709 16:87745735-87745757 CCCTTGCCCTCATAAACACCAGG - Intronic
1142335969 16:89489998-89490020 CCCGGGCCCCCAAAGACCCCCGG + Intronic
1203116584 16_KI270728v1_random:1496833-1496855 CCCTGGCCCCCAGCCACCACTGG + Intergenic
1143306194 17:5948771-5948793 TCCTGGCCCACAGAAACTACAGG - Intronic
1143740084 17:8946087-8946109 TCCTGGCCCACAGAATCCACGGG + Intronic
1143870527 17:9954697-9954719 CCCTGGCCCCTACCAACCAGAGG - Intronic
1144495361 17:15742072-15742094 CCCTGGCCCCCATAGGCCAGGGG + Intronic
1145946054 17:28775499-28775521 CCCTAGCCCCCAAAAACCCAGGG + Intronic
1148000278 17:44383739-44383761 CCCTAGCCCCAATATACCCCTGG - Intronic
1151292510 17:73160800-73160822 CCCCCGCCCCCTCAAACCACCGG + Intergenic
1151848987 17:76678584-76678606 TCCTGCCCCCCACACACCACGGG + Intronic
1152039736 17:77894953-77894975 CCCTGTCCCCCCTAAACTCCGGG + Intergenic
1152629955 17:81406411-81406433 CCCCGGTCCCCATTAACCTCTGG + Intronic
1153227717 18:2910670-2910692 CCTTGCCACCCATAAGCCACTGG + Intronic
1155274348 18:24171771-24171793 CCCTGGCCCCCACTAAACAAAGG + Intronic
1156461247 18:37322505-37322527 TCCTGGCACCCAGACACCACAGG - Intronic
1158678833 18:59548182-59548204 TCTTGGCCCCAACAAACCACTGG - Intronic
1160698349 19:495139-495161 CCCTGGACCCCATGCACCGCAGG - Intronic
1161205598 19:3039648-3039670 CCCAGGCCCCAACACACCACCGG + Intronic
1161824215 19:6551672-6551694 CCCTGGCCCCCCAAGAGCACAGG + Intergenic
1165743247 19:38216104-38216126 ACCCGGCCCCCAGAAACCTCAGG + Intronic
1166233483 19:41439717-41439739 TCCTGGCCCCCACTAGCCACAGG + Intronic
924995637 2:358211-358233 GCCTGGCTCCCGTAAAACACAGG - Intergenic
926721412 2:15964132-15964154 ACCTGGCCCCCAGAAGCCAAGGG - Intergenic
929771577 2:44896793-44896815 CCCTGGCCTCCATAATCTTCTGG - Intergenic
932130428 2:69182358-69182380 CCCTGGCCCTCAAAACCCAAAGG + Intronic
932562986 2:72888626-72888648 CCCTGTCCTCCAGAACCCACTGG + Intronic
933130084 2:78661593-78661615 CCCTGGCCCCCACCAATCCCTGG + Intergenic
933804598 2:85989005-85989027 CCCCGGAGCCCATAGACCACTGG + Intergenic
937900563 2:127016217-127016239 CTCTGGCCCCCCTAACCCAGAGG + Intergenic
941671224 2:168295161-168295183 TCCAGTCCCCCATGAACCACAGG - Intergenic
944344581 2:198646713-198646735 CCATGGCCTCCTTCAACCACAGG + Intergenic
945146116 2:206739935-206739957 CCCTGGCCCCCATAAACCACTGG + Intronic
1174053121 20:47781095-47781117 CCCTGGCCCCCCGAAAGCACAGG + Intronic
1174707842 20:52675226-52675248 CCCTGGCACCGGAAAACCACTGG - Intergenic
1175302297 20:57951505-57951527 CTCAGGCCCCCAGAAACCTCAGG - Intergenic
1175386845 20:58602225-58602247 CCTTGGCCCCCAGAAACCACTGG + Intergenic
1175505460 20:59481323-59481345 CCGTGGCCGCCACAAACCTCAGG - Intergenic
1178631112 21:34262202-34262224 CCCTGACCCCCAGAAAACAAAGG + Intergenic
1180007136 21:45028021-45028043 CCCTGGGCCCCAGAAGCCCCTGG + Intergenic
1181064213 22:20298143-20298165 CCCTGGCCTCCAGGAACCAGAGG - Intergenic
1181510081 22:23385172-23385194 CCCTGTCCCCAGTAAACCTCTGG + Intergenic
1182260652 22:29071452-29071474 CCCTGGGCCCCCTCAACCCCCGG - Intergenic
1184424004 22:44398475-44398497 CTCAGGCCCCCATCACCCACGGG - Intergenic
952936457 3:38402079-38402101 CCTTGGCCCCCAAATTCCACAGG + Intronic
953185915 3:40638262-40638284 TCCTAGGCCCTATAAACCACTGG - Intergenic
953233249 3:41083352-41083374 CCCTTTCCCCCATAACACACAGG + Intergenic
953667182 3:44933843-44933865 CCCTGCCCCCCATGAAGCAATGG - Intronic
954672278 3:52297498-52297520 CCCTGCCCCCTAGAAACCCCCGG - Intergenic
954785095 3:53086912-53086934 GCCTGGCCCCCATAAACTGCAGG + Intronic
958056360 3:88417416-88417438 CCCTTGCCCCTGTAAACTACGGG - Intergenic
959214026 3:103425985-103426007 CTCTTGCCCCCAAATACCACAGG - Intergenic
962665400 3:137649219-137649241 GCCTGGCCCCCAAAAACCTGAGG - Intergenic
967807796 3:193730764-193730786 CCATGGCCCCCACAAAGCCCTGG + Intergenic
968281798 3:197482822-197482844 CCCTGGCCAAGATAAACCCCAGG + Intergenic
968521562 4:1036783-1036805 CCCTGGGCCCCACACCCCACAGG + Intergenic
968603252 4:1520315-1520337 CCCCGGCACCCACAAGCCACGGG + Intergenic
969092020 4:4701828-4701850 CCCTGCCCCAGAGAAACCACAGG + Intergenic
969246289 4:5935213-5935235 CCCTGGCCTCTGTAAACCAGGGG + Intronic
972572276 4:40321326-40321348 CCATGTCCCCCATCACCCACAGG - Intergenic
972841333 4:42933263-42933285 CCTTTTCCCCCATAAAGCACTGG - Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
980966438 4:139525753-139525775 CCCTGTACCCCCTAACCCACTGG + Intronic
982252428 4:153420702-153420724 ACCTGGCCCTCACAAAGCACTGG - Intergenic
983472810 4:168177149-168177171 CACTGGCCCTCATAACCCTCAGG + Intronic
984562680 4:181289482-181289504 CTCTGGCAAGCATAAACCACAGG + Intergenic
985961543 5:3306667-3306689 CCCAGGCCCCCTGGAACCACAGG - Intergenic
986293455 5:6418361-6418383 CCCTGGACACCAGAAACCACGGG + Intergenic
988861727 5:35288079-35288101 CCCTGGTTCCCAGGAACCACAGG - Intergenic
991046851 5:62231821-62231843 CCCTGACCCCCAGCCACCACTGG - Intergenic
991243857 5:64488918-64488940 TCCTGGCCCCCAGAAACTCCTGG + Intergenic
991342691 5:65628718-65628740 CCTTGGCCCCCATAAAGTTCTGG + Intronic
993660796 5:90631708-90631730 CCCTGGCATCCACAAGCCACAGG - Intronic
995395415 5:111681754-111681776 CCCTGCCCCCCATAAATACCTGG - Intronic
999012283 5:148056081-148056103 CCATGGCCCCCTTCAGCCACTGG - Intronic
999522928 5:152371033-152371055 TCCTGGCCCTCCTAATCCACAGG - Intergenic
1001243057 5:170084690-170084712 CCCTGGCCCCCACTGCCCACTGG - Intergenic
1001266696 5:170279080-170279102 CCCTTCACCCCATAAACCCCTGG + Intronic
1002405141 5:179024448-179024470 CCCTGGCCCCAAAAAAACAAGGG - Intronic
1005772302 6:29086112-29086134 CCTTGGCCCCCACAAAGTACTGG + Intergenic
1006416044 6:33904485-33904507 CCCAACCCCCAATAAACCACTGG - Intergenic
1006797855 6:36742530-36742552 CCCTGGCCCCCAAAATCTCCAGG + Intronic
1007345955 6:41229550-41229572 CCCTGGCTCCCAACAAGCACAGG + Exonic
1007446046 6:41906977-41906999 CCCTGGACCCCAGAAACCCAGGG - Exonic
1010249190 6:73691097-73691119 CCCCGGCCACCAGAACCCACAGG + Intergenic
1010637916 6:78283327-78283349 CCCTGTCCCCAAAAACCCACAGG - Intergenic
1011707382 6:90015029-90015051 CTTTGGCCCCCACAAAGCACTGG + Intronic
1019490787 7:1312285-1312307 GCCTGGCTCCCAGAACCCACAGG - Intergenic
1019811920 7:3171134-3171156 CCATGGGCCCCACCAACCACGGG + Intronic
1020084522 7:5303319-5303341 CCCCGGCCCTCATCACCCACCGG + Exonic
1021197796 7:17691996-17692018 CCCTGCCCCCTACAAACCATCGG + Intergenic
1022093548 7:27123826-27123848 CCGTAGCCCCCACAAACCAAAGG + Intronic
1024286543 7:47762842-47762864 CCCAGCCCCCCACAAACCAGAGG - Intronic
1025662174 7:63562971-63562993 CCCCGGCCCTCATCACCCACTGG + Intergenic
1025728275 7:64087788-64087810 CACTGGCTCCCATAAGCCTCAGG + Intronic
1025996027 7:66528146-66528168 CCCTGGCCCCCAGAAATCCCTGG - Intergenic
1026660076 7:72292980-72293002 CCCTGCCCCCCAGAAAGCTCTGG - Intronic
1026987671 7:74564979-74565001 CCCTGGCCCCCAGAAACCCCTGG - Intronic
1027631472 7:80611130-80611152 TCTTGGGCCCCACAAACCACTGG + Intronic
1028800759 7:94963453-94963475 CCCTGGCTCACATTAGCCACAGG + Intronic
1029117628 7:98245350-98245372 CCTAGGCTCCCAGAAACCACTGG + Intronic
1029226737 7:99034073-99034095 CCCAGGACCCCAGAAACCAGGGG - Intronic
1032414080 7:131722791-131722813 CCCTAGCCCCCATATATCAGAGG + Intergenic
1034274981 7:149820062-149820084 CCCTGGCCACCCCAACCCACAGG + Intergenic
1035992434 8:4507424-4507446 GCCTGGCACCCATAAAACACTGG - Intronic
1036688799 8:10928444-10928466 CCATGTCCCCCCTAAACCCCTGG + Intronic
1038385504 8:27140620-27140642 CCCAGTCCCCCAGGAACCACAGG - Intergenic
1042433414 8:68735191-68735213 CCCTGGCCTCCAGAAACTAGTGG - Intronic
1044191489 8:89324002-89324024 CTTTTGCCACCATAAACCACAGG + Intergenic
1044890771 8:96832946-96832968 CCCTGGCCCTCCCATACCACCGG - Intronic
1048268494 8:133008996-133009018 CCCTGGCCTGCATGAACCCCTGG - Intronic
1048941743 8:139405917-139405939 TACTGGCACTCATAAACCACCGG - Intergenic
1049109253 8:140633509-140633531 CCTTGGCCCTCATGATCCACAGG - Intronic
1051082802 9:13312550-13312572 CCTTGGCCCCCATATCCCACAGG - Intergenic
1055574108 9:77645912-77645934 CCCTGAACCCCACAAACCAGAGG - Intronic
1055970574 9:81907848-81907870 CCAGGGCCCCCATAAACCAAAGG + Intergenic
1056677347 9:88686659-88686681 CCCTGTCCCCCATCACCCAAAGG + Intergenic
1057257611 9:93563115-93563137 GAATGGCCCCCATAAACCAAGGG - Intronic
1058275651 9:103038191-103038213 CCCTGTCCCCCAACACCCACAGG + Intergenic
1058979935 9:110159843-110159865 CCCTGACTCCCATAAGCCAGGGG - Intronic
1060302349 9:122382094-122382116 CCCTGCCCTCAAAAAACCACAGG + Intronic
1060839446 9:126782199-126782221 CCCAGGCCCCCATGAACCCCAGG - Intergenic
1061433706 9:130547338-130547360 TCCTGGGCCCCAAAACCCACAGG - Intergenic
1186878683 X:13842468-13842490 CCCTGGGCTTCATAAACCACAGG - Intronic
1189102620 X:38207063-38207085 CCATGGCACCCATAATCCCCAGG + Intronic
1190526614 X:51334457-51334479 CCCTGACTCCCAGTAACCACAGG + Intronic
1190542634 X:51494907-51494929 CCCTGACTCCCAGTAACCACAGG - Intronic
1196581647 X:117386424-117386446 CCCTGACCCGCAGAAACCACAGG - Intergenic
1200046021 X:153401382-153401404 CCCGGGCTCCCAGAAACCCCTGG + Intergenic
1200160062 X:154002530-154002552 CCCTGTCCCTCAGAAACCACAGG + Intergenic
1201349507 Y:13023928-13023950 CTCTGGCCCCAACTAACCACTGG - Intergenic