ID: 945149725

View in Genome Browser
Species Human (GRCh38)
Location 2:206777383-206777405
Sequence GGTTGTTGAATTTCATCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 69, 3: 111, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945149723_945149725 -10 Left 945149723 2:206777370-206777392 CCCTTATCATAAAGGTTGTTGAA 0: 1
1: 0
2: 0
3: 15
4: 231
Right 945149725 2:206777383-206777405 GGTTGTTGAATTTCATCAAATGG 0: 1
1: 0
2: 69
3: 111
4: 326
945149721_945149725 6 Left 945149721 2:206777354-206777376 CCTAATTTGTTGAGAGCCCTTAT 0: 1
1: 0
2: 26
3: 215
4: 1038
Right 945149725 2:206777383-206777405 GGTTGTTGAATTTCATCAAATGG 0: 1
1: 0
2: 69
3: 111
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945149725 Original CRISPR GGTTGTTGAATTTCATCAAA TGG Intronic
900121271 1:1049611-1049633 GGTTGTTGACGTCCAGCAAACGG - Exonic
902491434 1:16784924-16784946 GGGTGTTGAATTTTGTCAAATGG + Intronic
902967703 1:20021120-20021142 AGATGTTGAATTTTATCAAATGG + Intergenic
902982531 1:20135859-20135881 GGATGTTGGATTTTGTCAAATGG + Intergenic
904426755 1:30430380-30430402 GTTTGTTGAAGTTCATCATTAGG - Intergenic
906191370 1:43901501-43901523 GGTTCTTAAAATTCATCCAAGGG + Intronic
907180204 1:52562881-52562903 TGTTCTTGAATTTCAAAAAATGG - Intergenic
907418670 1:54331960-54331982 GGCTGGTGATTTTCATGAAAGGG - Intronic
908075466 1:60513075-60513097 CGTTGTTGAATTTTGTCAAAGGG - Intergenic
909316595 1:74227628-74227650 AGATGTTGAATTTTAGCAAATGG - Intronic
913176964 1:116282787-116282809 GGAGGTTGAATTTTATCAAAAGG + Intergenic
914979692 1:152402409-152402431 GGTTGTTGAATTTTGTTCAAAGG + Intergenic
916006994 1:160671478-160671500 GGTTATAGAAAGTCATCAAAGGG + Intergenic
916379478 1:164193679-164193701 GGATGTTGAATTTTATCGAATGG - Intergenic
917022969 1:170610420-170610442 GGGTGTTGAATTTTATCAAAGGG + Intergenic
917473506 1:175347237-175347259 TGTTGTTAAACTTTATCAAATGG - Intronic
918089786 1:181279759-181279781 CGTTGCTGAATTTTGTCAAAGGG - Intergenic
918503493 1:185225129-185225151 GGATGTTGAATTTTGTCAAATGG + Intronic
918908781 1:190536968-190536990 GGATGCTGAATTTTATCCAATGG - Intergenic
918986661 1:191638009-191638031 TGTTCTTGAACTTCATAAAAAGG - Intergenic
919100060 1:193084606-193084628 GTTTGTGGAATGACATCAAATGG + Exonic
919108735 1:193189962-193189984 GGTGGATGATTTTCATCTAATGG + Intronic
919511946 1:198475981-198476003 GGTTGTTGAATTTTGTTGAAAGG + Intergenic
919580789 1:199369466-199369488 TTTTGTTGAATTTCAACAGATGG + Intergenic
922888696 1:229043144-229043166 GGGTATTGAATTTTGTCAAATGG - Intergenic
923004762 1:230039141-230039163 GGGTATTAAATTTCATTAAATGG + Intergenic
923345633 1:233049416-233049438 GGATGTTGAATTTTATTGAAAGG - Intronic
923466815 1:234255607-234255629 GGTTGTTCAATGTCTTCCAAGGG - Intronic
923529009 1:234797618-234797640 GGGTGTTGAATTTTGTCAAATGG - Intergenic
1063179743 10:3587301-3587323 TGATCTTGATTTTCATCAAATGG - Intergenic
1063179749 10:3587422-3587444 TGATCTTGATTTTCATCAAACGG - Intergenic
1064023009 10:11824017-11824039 TTTTGTTCAATTTCATCACACGG - Intronic
1064241075 10:13629618-13629640 TGTTTTTGAATTTTATGAAAAGG + Intronic
1064449452 10:15428432-15428454 TGTTGTTGTTTTTCATCGAAAGG - Intergenic
1064609578 10:17084227-17084249 TGTTGATGAATGTCATCTAAGGG + Intronic
1066819577 10:39468473-39468495 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1068285323 10:54926158-54926180 GAATGTTGAATTTCATCCAAAGG + Intronic
1068552271 10:58419987-58420009 GGCTGTTGAATTTTGTCAAAGGG + Intergenic
1069096381 10:64264591-64264613 TGTTCTTGAATATCATCAAATGG - Intergenic
1069341484 10:67414945-67414967 GAATGTTGAATTTTATCAAAAGG - Intronic
1072017014 10:91358189-91358211 GGATTTTGAATTGGATCAAATGG - Intergenic
1072835202 10:98703700-98703722 AGATGTTGATTTTTATCAAAGGG - Intronic
1073667887 10:105553996-105554018 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
1074022637 10:109599767-109599789 GGATGTTGAATTTTATCAAAGGG - Intergenic
1074042403 10:109804133-109804155 GGATGTTGAATTTTATTGAAAGG - Intergenic
1074455448 10:113591888-113591910 GGTTGTTGATTTGCAATAAAAGG - Intronic
1077064315 11:633071-633093 GGGTTTTGAATTTTATGAAATGG + Intergenic
1077780222 11:5319639-5319661 GGATGTTGAATTTTATTGAAAGG - Intronic
1078590751 11:12638701-12638723 GGTTTTTACATTTCATTAAATGG + Intergenic
1078770646 11:14348239-14348261 AGATGTTGACTTTCATCACATGG + Intronic
1079824184 11:25169857-25169879 AGATGTTGAAATTTATCAAAAGG - Intergenic
1080329898 11:31124231-31124253 GGATGTTGAATTTTATCGAAGGG + Intronic
1080355615 11:31441287-31441309 GCTTGTTGAATTTTTTTAAAAGG + Intronic
1081246734 11:40775984-40776006 GGATTTTGGATTTTATCAAAAGG + Intronic
1081454603 11:43208919-43208941 GGATGTTGAATTTTATCAAAGGG + Intergenic
1082111878 11:48285923-48285945 GGATGTTGAATTTTATCAAAGGG + Intergenic
1082220277 11:49626798-49626820 TTATGTTGAATTTTATCAAATGG + Intergenic
1082599918 11:55136621-55136643 TGTTGTTGAATTTTGTCAACGGG - Intergenic
1082650197 11:55781271-55781293 GGATGTTGGATTTTATCAAAAGG - Intergenic
1083123173 11:60535954-60535976 GGTTGTTGAATTTTGTCAAAGGG - Intronic
1083698794 11:64460415-64460437 GGTTTTTGAATATTGTCAAATGG + Intergenic
1086012647 11:82123876-82123898 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
1087402039 11:97679817-97679839 CGATGTTGAATTTTATCAAATGG + Intergenic
1087416914 11:97868440-97868462 GGATGTTGAATTTTATCAAATGG + Intergenic
1087482866 11:98723089-98723111 GGATGTTGAATTTTATTGAAGGG + Intergenic
1088077950 11:105875125-105875147 GGGTGTTGAATTTTACCGAAGGG + Intronic
1088342550 11:108785134-108785156 GGATGTTGGATTTTATCAAAAGG + Intronic
1088491823 11:110396129-110396151 GGATGTTGAATTTTATCAAATGG + Intergenic
1089021032 11:115215229-115215251 GGATTTTGAGTTTCACCAAAAGG + Intronic
1089356865 11:117859626-117859648 AGTTCTTGGATTTCATGAAAGGG - Intronic
1089392016 11:118108652-118108674 GGGTGTTGAATCCAATCAAACGG + Intronic
1090422561 11:126585557-126585579 GTTTGTGGAATTTTATCAAGAGG + Intronic
1090689227 11:129160031-129160053 CAGTGTTGAATTTTATCAAAGGG - Intronic
1092064052 12:5574884-5574906 GGTTGTTGAATTTGAAGAGATGG - Intronic
1092438213 12:8471006-8471028 GGATGTTGTATTTTGTCAAATGG + Intronic
1093403725 12:18779123-18779145 GGATGTTGAATTTTATTAAAGGG - Intergenic
1093574384 12:20709981-20710003 GGTTTTATAATTTTATCAAAGGG - Intronic
1093592529 12:20920395-20920417 AGGTGTTGAATTTTGTCAAATGG + Intergenic
1093803452 12:23402183-23402205 TGTTGTTGCATTTCATCACTTGG + Intergenic
1093952489 12:25179711-25179733 GGATATTGGATTTTATCAAAAGG - Intronic
1094106324 12:26815615-26815637 GGTGTTTGCATTACATCAAAAGG + Intronic
1094225896 12:28045638-28045660 CGATGTTGACTTTTATCAAAAGG + Intergenic
1095128779 12:38512562-38512584 GGCTGTTGAATTTCGTTGAAGGG - Intergenic
1095150427 12:38788388-38788410 AGATGTTCAATTTGATCAAATGG - Intronic
1095152017 12:38806532-38806554 GGTTGTTGAATTTTGTCAAAGGG - Intronic
1096183102 12:49561535-49561557 AGTTTTTGTATTTCTTCAAAAGG - Intronic
1097270575 12:57771658-57771680 GTTTGTTGGATTTAATAAAAAGG - Intronic
1097531809 12:60810786-60810808 GGTTGTTGAATTTTGTCAAAAGG + Intergenic
1097532551 12:60822884-60822906 GTTTGTTTAATTTCATAAAAGGG + Intergenic
1098619443 12:72575749-72575771 GCTTGATGAATTTCACCACAAGG + Intronic
1098844538 12:75519644-75519666 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1099010956 12:77290473-77290495 AGGTGTTGAATTTTATCGAAGGG - Intergenic
1099114108 12:78602552-78602574 GGATGTTGGATTTTATCAAAAGG - Intergenic
1099150277 12:79102856-79102878 GGTAATAGAATTTCATAAAATGG + Intronic
1099391476 12:82085776-82085798 GAGTGTTGAATTTTGTCAAAAGG + Intergenic
1099582963 12:84476749-84476771 GGATGTTGAATTTCATTAAATGG - Intergenic
1101270268 12:103135837-103135859 AGATGTTGAATTTTATCAAATGG - Intergenic
1104616009 12:130269250-130269272 GGTGTTTCAACTTCATCAAAAGG + Intergenic
1105546799 13:21356468-21356490 GGATGCTGAAATTCATGAAAAGG + Intergenic
1106122102 13:26868865-26868887 GGTTGATTGATTGCATCAAATGG - Intergenic
1106526802 13:30548000-30548022 GCTTGTTGCATTTTATCTAATGG + Intronic
1107135156 13:36936244-36936266 GGATGTTGAACTTTGTCAAATGG + Intergenic
1108300723 13:49072321-49072343 GGTTGTTGAGTTTCATGTCAAGG + Intronic
1108815299 13:54283537-54283559 GGATGTTGAATTTTATTAAAGGG + Intergenic
1108868817 13:54957058-54957080 TGGTGTTGAATTTTATCAAATGG + Intergenic
1108938448 13:55916621-55916643 GATTGTTAAATTACATGAAAGGG + Intergenic
1108966689 13:56315137-56315159 GGTTGTGTAATTTCAGTAAATGG + Intergenic
1110258182 13:73455193-73455215 GGCTGTTGAATTTTGTCAAAGGG + Intergenic
1110460661 13:75741661-75741683 CAGTGTTGAATTTTATCAAAAGG - Intronic
1110890635 13:80693529-80693551 TGATGTTGAATCTTATCAAAGGG - Intergenic
1111711593 13:91821646-91821668 GGATATTGAATTTTATCATATGG + Intronic
1112902416 13:104374309-104374331 GGTGGTTGAATCTCCTCATAAGG + Intergenic
1113138756 13:107123125-107123147 GGTTTCTGAATTTCATAAATAGG - Intergenic
1113488458 13:110673493-110673515 GGCTGTTGAATTTTGTCAAAAGG - Intronic
1114279102 14:21174268-21174290 GGATGTTGAATTTTATCAAAAGG - Intergenic
1114724742 14:24923909-24923931 GGTTGTTAATTTGCATTAAAAGG - Intronic
1115861582 14:37692476-37692498 GGATGTTGAATTTTATCAAATGG - Intronic
1115942438 14:38624163-38624185 GGATGTTGAATTTTATCAAATGG - Intergenic
1116252723 14:42507626-42507648 GGGTGTTGAATTTTATTGAAAGG - Intergenic
1116334848 14:43644278-43644300 GGATGCTGGATTTAATCAAATGG - Intergenic
1116358065 14:43956730-43956752 GGATATTGAATTTTATCGAAAGG - Intergenic
1116569637 14:46499197-46499219 GGGTGTTGAATTTTGTCAAAGGG + Intergenic
1116672987 14:47867474-47867496 ACTTGTCAAATTTCATCAAAGGG - Intergenic
1117577684 14:57115998-57116020 AGTTGTTGAATTTTGTCAAAGGG - Intergenic
1120772968 14:88401278-88401300 GGATGCTGAATTTTGTCAAATGG - Intronic
1121097961 14:91231020-91231042 AGTTGTTGAATTAAAGCAAATGG + Intergenic
1121401739 14:93685272-93685294 TGTTCTTGAATTTCTTGAAAGGG - Intronic
1124056841 15:26248841-26248863 TGATGTTGAATTTTGTCAAACGG + Intergenic
1124092306 15:26617444-26617466 CATTGTTGAATTTTGTCAAAGGG - Intronic
1124986815 15:34625785-34625807 GGATATTGAATTTTATCATATGG + Intergenic
1125354183 15:38799679-38799701 GGCTGTTGAATTTTGTTAAAGGG + Intergenic
1126365825 15:47893383-47893405 GGGTGTTGAATTTTATCAAAGGG - Intergenic
1126586751 15:50296620-50296642 GGTTGAATAATTTTATCAAAGGG - Intronic
1126897764 15:53277949-53277971 GGATGTTGAATTTTATCAAATGG - Intergenic
1126949621 15:53867018-53867040 GGATGTTGAACTTCATCAAATGG - Intergenic
1126957220 15:53946707-53946729 GGTTATTGAATTTTATCAAAAGG + Intergenic
1131736760 15:95341029-95341051 GTGTGTTGAAATTTATCAAAAGG + Intergenic
1132915892 16:2343251-2343273 GATTGTTGAAGGGCATCAAAAGG - Intergenic
1134908933 16:18006541-18006563 GCTTGATGAGTTTCAACAAATGG + Intergenic
1135876346 16:26203895-26203917 GCTTCTTGAACTCCATCAAAAGG + Intergenic
1136245600 16:28974239-28974261 GGTTGGGGAATCTCAACAAAGGG + Intronic
1137075322 16:35954601-35954623 GGCTGTTGAATTTTGTCAAAGGG + Intergenic
1137298068 16:47116370-47116392 GGGTGATGAATTTTAACAAATGG + Intronic
1138215456 16:55201095-55201117 GGTATGTGTATTTCATCAAATGG + Intergenic
1138395007 16:56697310-56697332 GGTTGTCAAATTTTATCAAATGG - Intronic
1138681875 16:58689802-58689824 GGGTGTTGGATTTTGTCAAATGG + Intergenic
1139863492 16:70045358-70045380 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
1141123567 16:81383165-81383187 TGATGTTTAATTTCATGAAAAGG - Exonic
1145003914 17:19325505-19325527 GGCTAATGAATTTTATCAAATGG - Intronic
1146280936 17:31543920-31543942 GGCTGTGAAATTTGATCAAAGGG + Intergenic
1146518318 17:33506935-33506957 GGAGGCTGAATGTCATCAAAAGG + Intronic
1148340270 17:46869263-46869285 GTTTTTTAAATTTCATCTAATGG - Intronic
1150118724 17:62580290-62580312 AGTTTTTGAATTTCAACCAATGG - Intronic
1150518988 17:65847064-65847086 GGTTGGTGAATTCCACCAACTGG + Intronic
1150597709 17:66621236-66621258 GGTGTTTGATTTTCATTAAATGG + Intronic
1153328260 18:3844410-3844432 GGATTTTGATTTTCATCAGATGG - Intronic
1153371738 18:4324796-4324818 GGATGTTGAATTTTATCAAAAGG - Intronic
1154258271 18:12805151-12805173 CTATGTTGAATTTTATCAAATGG - Intronic
1155723128 18:29044610-29044632 TGTTGTTTAATTTTATCAAAAGG + Intergenic
1155765441 18:29625655-29625677 GGTAGTTAAACTTCATTAAAAGG + Intergenic
1156084106 18:33378647-33378669 TGATGTTGGATTTTATCAAAAGG + Intronic
1156626533 18:38916497-38916519 GGGTGTTGAATTTTATCAAAGGG + Intergenic
1158100718 18:53827153-53827175 CGATGTTGAATTTCATTGAAAGG - Intergenic
1158754319 18:60303838-60303860 GGTTGCTGAATTTTGTCGAAGGG - Intergenic
1159235518 18:65667870-65667892 GCTTGTCTAAATTCATCAAATGG - Intergenic
1160108139 18:75998874-75998896 GGTTTATGTATTTCACCAAATGG + Intergenic
1162277405 19:9667296-9667318 GGATATTGAATTTTATCAAATGG - Intronic
1166176141 19:41072134-41072156 GGATGTTGAATTTTATGAAAAGG + Intergenic
1166604842 19:44131937-44131959 GGATCTTGACTTTCATCAGAGGG + Exonic
1166620467 19:44294868-44294890 GGATGCTGAATTTTGTCAAATGG - Intronic
1167398553 19:49248584-49248606 AGGTGTTGAATTTTGTCAAATGG + Intergenic
925434180 2:3821589-3821611 GGATGTTGAATTTTGTAAAATGG + Intronic
926566719 2:14483782-14483804 GGGTGTGGAATTTTATCCAAAGG - Intergenic
928633510 2:33218087-33218109 GGTTTTCAAATTTCATTAAAAGG + Intronic
928711564 2:34012622-34012644 TGTTGTTGGAATTCATCAAACGG + Intergenic
928889414 2:36185843-36185865 TGTTCTTTGATTTCATCAAAAGG - Intergenic
929537852 2:42794848-42794870 AGTTGCTGAATTACATGAAAGGG - Intergenic
930423992 2:51190427-51190449 CAATGTTGAATTTTATCAAAGGG + Intergenic
931043976 2:58329256-58329278 CGTTGTTGAATTTTGTCAAAGGG - Intergenic
931557986 2:63526005-63526027 GGCTTTTGAATTTCAGGAAAGGG + Intronic
931796136 2:65711930-65711952 GGTTGTTGAGTCTGAGCAAAGGG - Intergenic
931985827 2:67741167-67741189 GGCTGTTGAATTTTGTCAAAGGG + Intergenic
933450982 2:82451333-82451355 GGATGCTGAATTTTACCAAATGG - Intergenic
933892872 2:86787658-86787680 CGTTGTAGGCTTTCATCAAATGG + Intronic
934031766 2:88055209-88055231 GGATGCTGAACTTCACCAAACGG + Intronic
934836890 2:97598244-97598266 GGCTGTTGAATTTTGTCAAAAGG + Intergenic
934996848 2:98970619-98970641 GGATGTTGAATTTTATCAAATGG + Intergenic
937561178 2:123225597-123225619 GGATGTTGAATTTTATCAAATGG - Intergenic
937826941 2:126376897-126376919 GGATGTTGAATTTTATTGAAAGG + Intergenic
938231507 2:129664698-129664720 AGCTGTTGAATTTTATCAAATGG - Intergenic
938709798 2:133966383-133966405 GATTGTTGAATTTAATCACAGGG - Intergenic
939011913 2:136856352-136856374 GTTTGTTATGTTTCATCAAAAGG + Intronic
939033620 2:137105337-137105359 GGGTGTTGAATTTTATTGAAGGG - Intronic
939763222 2:146211084-146211106 GGTTGTTGGATTTCAACAGCTGG + Intergenic
939829234 2:147052944-147052966 AGTTTTGGAATTTGATCAAATGG + Intergenic
940887096 2:158999623-158999645 GGTTTTTTTCTTTCATCAAAGGG + Intronic
941338874 2:164280360-164280382 GGATGTTGAATTTTGTCAAATGG + Intergenic
941380091 2:164781936-164781958 TGTTGTTGAATTTTTTAAAATGG + Intronic
942692646 2:178602893-178602915 TATTGTAGAATTTCTTCAAAGGG - Intronic
942695738 2:178642507-178642529 TGGAGTTGAATTTCATCACAAGG - Intronic
943706450 2:191039960-191039982 AGTTGTTAAAGTTCCTCAAATGG - Intronic
943888776 2:193258214-193258236 AGTTGTTGAATTTTGTAAAAAGG + Intergenic
944292404 2:198022164-198022186 GGGTGTTGAATTTTATTGAAGGG - Intronic
945149725 2:206777383-206777405 GGTTGTTGAATTTCATCAAATGG + Intronic
945171834 2:207004700-207004722 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
946837979 2:223791463-223791485 GGATGTTGAATTTTATCAAAGGG - Intronic
1169700986 20:8446338-8446360 GGTTGTTGAATTGTGTCAAAGGG - Intronic
1170124583 20:12949280-12949302 GGTTGTTGAATTTCAGTGTAAGG + Intergenic
1170247425 20:14238337-14238359 GGATGTTGAATTTCATTAAAAGG - Intronic
1171001231 20:21417765-21417787 GGGTGTTGAATTTTATCAAAGGG - Intergenic
1171923411 20:31169360-31169382 AGTTGTCGAATTGAATCAAATGG + Intergenic
1173203707 20:40973939-40973961 GGCTGTTGAATTTTATCAAATGG + Intergenic
1173992224 20:47312253-47312275 AGTGGTTGACTTTCATGAAAAGG + Intronic
1174988976 20:55488088-55488110 TGCTCTTGAATTTCAACAAAGGG - Intergenic
1175366373 20:58459108-58459130 GGCTGTTTAATTTTATTAAAAGG + Exonic
1176361909 21:6004765-6004787 AGATGTTGAATTTTGTCAAAAGG + Intergenic
1176636578 21:9249327-9249349 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
1177761232 21:25404197-25404219 GGATGTCAAATTTTATCAAATGG - Intergenic
1177970439 21:27782658-27782680 GAATGTTGAATTTTATCAAATGG - Intergenic
1178937086 21:36872572-36872594 TGTTCTTCAATTTCATAAAATGG + Intronic
1179596323 21:42445316-42445338 GACTGATGAATTTCATAAAAAGG - Intronic
1179761609 21:43533780-43533802 AGATGTTGAATTTTGTCAAAAGG - Intronic
1180254440 21:46614725-46614747 TGGTGTTGAATTTTATCAAAAGG + Intergenic
1180577195 22:16788921-16788943 AGATGTTGAATTTTGTCAAATGG - Intronic
1181360909 22:22334686-22334708 GGATGTTGAATTTTATCAAAGGG - Intergenic
1183749147 22:39709547-39709569 TTTTGGTCAATTTCATCAAAAGG + Intergenic
949532448 3:4969682-4969704 GGCTGTTGAATTTTGTCAAAAGG - Intergenic
949792114 3:7804082-7804104 GGTGGTTGAATGTAATGAAAAGG - Intergenic
950624413 3:14234260-14234282 TGCTGTAGAATTTCATCAAGTGG + Intergenic
951468118 3:23024277-23024299 GGGTGCTGGATTTTATCAAATGG - Intergenic
953154593 3:40357832-40357854 GGGTGTTGAATTTTATCAAATGG - Intergenic
953299608 3:41758960-41758982 GGATGTTGAATTTTGTAAAATGG - Intronic
955538155 3:59946723-59946745 GGATGTCTAATTTTATCAAAAGG + Intronic
955641148 3:61086309-61086331 AGATGTTGAATTTTATCATATGG + Intronic
956027229 3:64996159-64996181 CATTGTAGTATTTCATCAAATGG - Intergenic
956396265 3:68829400-68829422 GGCTGTTGAATTTTGTCAAAGGG + Intronic
956854751 3:73264903-73264925 GGCTGTTGAATTTTATTGAAAGG - Intergenic
957595524 3:82260079-82260101 GGTTCTTGACTTACAGCAAAAGG + Intergenic
957727428 3:84086223-84086245 GGATATTGAATTTTATCAACTGG - Intergenic
957727855 3:84090524-84090546 GGCTGTTGAATTTTGTCAAAGGG - Intergenic
957844775 3:85717699-85717721 CGTTGTTGAATTATATCGAAGGG + Intronic
957894864 3:86409026-86409048 GGTTGTTGAATTTAATTAAAAGG + Intergenic
958153906 3:89728769-89728791 GGATATTGACTTTTATCAAAAGG - Intergenic
958752084 3:98203570-98203592 GGTTGTTCAATTTGCTTAAAAGG - Intergenic
958756579 3:98256512-98256534 TGATGTTGAATTTTATCAAATGG + Intergenic
959042211 3:101435200-101435222 AACTGTTGAATTTTATCAAATGG - Intronic
959285666 3:104405863-104405885 GAATGTTGAATTTTATAAAATGG - Intergenic
959876028 3:111383145-111383167 GGGTGTTAAATTTTATCAATGGG - Intronic
959994487 3:112665234-112665256 GGATGTTGGATTTTATCAAAAGG + Intergenic
960000638 3:112728040-112728062 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
960450193 3:117797471-117797493 AGTTGTTGAATGTCTTCCAAAGG + Intergenic
961952748 3:130767353-130767375 AGATGTTGAATATTATCAAATGG - Intergenic
962182150 3:133218611-133218633 GGATGTTGAATTTTTTCAAACGG + Intronic
962668252 3:137678578-137678600 AGATGTTGAATTTTATCAAATGG - Intergenic
964114892 3:153125766-153125788 GGATGTTGAATTTTATTGAATGG + Intergenic
964646930 3:158968691-158968713 GTTTGTTGAATTATATCTAAAGG - Intronic
965013156 3:163123456-163123478 GGATGTTGAATTTAGGCAAATGG + Intergenic
965034340 3:163417685-163417707 GCCTGTAGAATTTCAACAAAAGG + Intergenic
966079659 3:175985131-175985153 GGATGTTGGATTTCATTGAAAGG + Intergenic
966753558 3:183346343-183346365 AGGTGTTGAATTTTATCGAAGGG - Intronic
967107523 3:186266199-186266221 GGCTTTTGAATTTCATATAATGG + Intronic
970329773 4:14967954-14967976 GGTTGCTGTTTTTCACCAAAAGG - Intergenic
970358525 4:15282442-15282464 GGTTTTTGAATTTTGTCAAAGGG - Intergenic
971116440 4:23651514-23651536 ATTGGTTGAATTTAATCAAAAGG + Intergenic
973180943 4:47266556-47266578 GGTTGTTTAATTTCATATATTGG + Intronic
973972641 4:56228753-56228775 GGTTGTGGAGTTTTATCAAGAGG + Intronic
973999592 4:56498204-56498226 GGGTGTTGAATTTTATTGAAGGG - Intronic
974193173 4:58534917-58534939 AGATGTTGACTTTTATCAAATGG + Intergenic
974814286 4:66985382-66985404 GGATGTTGAATTTTATCAAAGGG + Intergenic
975145902 4:70966957-70966979 GGATTTTGAATTTTAGCAAATGG - Intronic
975949494 4:79751565-79751587 GGATGTAGAATTTTGTCAAATGG - Intergenic
976455331 4:85240122-85240144 GGGTGTTGAATTTTATTGAAGGG - Intergenic
976535749 4:86214159-86214181 GGGTGTTGAATTTTGTCAAATGG - Intronic
976540613 4:86270742-86270764 TGTTCTTGCATTTCATAAAATGG + Intronic
977307789 4:95346694-95346716 GGATGTTGAATTTTATCAAATGG - Intronic
978114875 4:105007033-105007055 GGATGTTGAATTTTATCAAATGG - Intergenic
978136460 4:105267893-105267915 GAATGTTGAATATTATCAAATGG - Intronic
978684807 4:111427463-111427485 GGATGTTGAATGTCATCAAATGG - Intergenic
978796912 4:112716997-112717019 GTTTGCTTAATTTCATTAAAAGG - Intergenic
979868655 4:125788601-125788623 GTTTGTTGAATTTTATGACAAGG + Intergenic
980347473 4:131640191-131640213 AGATGTTGAATTTTATCAAATGG - Intergenic
980414064 4:132461678-132461700 CGCTGTTGAATTTTGTCAAAGGG - Intergenic
980637427 4:135526243-135526265 GGGTGTTGAATTTTATCGGAGGG - Intergenic
981556931 4:146005090-146005112 GGATACTGAATTTTATCAAATGG + Intergenic
981797733 4:148616120-148616142 GGTTGTTGGATTTCTTTAAGAGG - Intergenic
983359230 4:166706888-166706910 TGGTGTTGAATTTTGTCAAATGG + Intergenic
983620416 4:169755696-169755718 AGTTTTTGAACTTCATAAAAAGG - Intronic
983799334 4:171906924-171906946 GGTTGTTGAATTTTGCCAAAGGG - Intronic
983814944 4:172112692-172112714 GGTGTTAGAATTTCAACAAATGG - Intronic
984355121 4:178648076-178648098 GGATTTTGAATTTTATCAAATGG + Intergenic
985232323 4:187833625-187833647 GGATGTTGAATTATGTCAAAAGG + Intergenic
1202751466 4_GL000008v2_random:7766-7788 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
986159059 5:5207734-5207756 GAGTGTTAAATTTTATCAAATGG + Intronic
986884900 5:12221865-12221887 GGATGTTAAATTTTATCAAATGG + Intergenic
987530922 5:19118399-19118421 GGATGTTGAATATTATCAAAAGG - Intergenic
987648291 5:20705304-20705326 TGTTGTTGATTATCATCCAAAGG - Intergenic
987861026 5:23488273-23488295 GGATGCTAAATTTTATCAAAAGG + Intergenic
988340693 5:29967077-29967099 AGGTGTTGAATTTTATCTAAAGG - Intergenic
988640263 5:33033946-33033968 TGTTGTTGGATTTCGTCAATGGG - Intergenic
988748037 5:34163594-34163616 TGTTGTTGATTATCATCCAAAGG + Intergenic
989005504 5:36806803-36806825 GGATGTTGAAGTTTATCGAATGG + Intergenic
989073469 5:37536619-37536641 AGGTGTTGAACTTCATCAAATGG + Intronic
989347847 5:40450144-40450166 GGATGTTGAATTTTATCAAAGGG + Intergenic
989738252 5:44735099-44735121 GGATGTTGAGTTTTACCAAATGG - Intergenic
989778545 5:45237321-45237343 GGATGTTGAATTTTATCAAAGGG + Intergenic
990015101 5:51051162-51051184 GCTTGTTGAATTAAATGAAATGG + Intergenic
990038611 5:51352588-51352610 CGTTTTTGAATTTTGTCAAAGGG - Intergenic
990167800 5:53014311-53014333 GGATGTTGAATTTTATCGAAAGG + Intronic
990432973 5:55755372-55755394 GGCAGTTGAATGTTATCAAATGG + Intronic
990655033 5:57945563-57945585 GGCTGTTGAATTTTGTCAAAGGG + Intergenic
991205626 5:64046878-64046900 GGATGTTGAATTGTATCAAATGG - Intergenic
992587572 5:78256949-78256971 GGATGTTGGATTTTATCAAACGG - Intronic
992794525 5:80243871-80243893 GTTTGTGGAATCTCATCAACTGG - Intronic
992860917 5:80909025-80909047 GGATGTTGAATTGTGTCAAATGG - Intergenic
993510110 5:88760485-88760507 TGTTGTTGAATTTCATGTATAGG + Intronic
993738901 5:91511847-91511869 GGTTGTTGAATTACTCCAGAGGG + Intergenic
993790439 5:92201846-92201868 TATTCTTGAATTTCATGAAAAGG + Intergenic
993818846 5:92588827-92588849 GGTGGTTGCATTTCATCATAGGG - Intergenic
993956331 5:94237980-94238002 GTTTGCTGAAATTCATCAAATGG + Intronic
994119638 5:96099536-96099558 GGATGCTGAACTTTATCAAAAGG + Intergenic
994642304 5:102425049-102425071 GGGTGTTAAATTTTATCGAAGGG - Intronic
994644035 5:102447076-102447098 GGATATTGAATTTTATCAAAAGG + Intronic
994888744 5:105601531-105601553 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
995576402 5:113540237-113540259 GGTGGTAGAACTTCAACAAATGG + Intronic
996111391 5:119570444-119570466 TGTTGTTAAAATCCATCAAAAGG + Intronic
996116076 5:119620473-119620495 GGATTTTGAATTTTATCAGATGG + Intronic
996141852 5:119920871-119920893 GGATGTTGAATTTTATCAAAAGG + Intergenic
996649418 5:125855522-125855544 GGTTTTTGAATTTTGTCAAAGGG + Intergenic
996883107 5:128323469-128323491 GGGTGTTGAATTTTATTGAAGGG + Intronic
997289402 5:132716251-132716273 GGTTTTTGAATTTCCTCCTAAGG + Exonic
997343563 5:133167416-133167438 GGCAGTTGAATTTTGTCAAAGGG + Intergenic
998650216 5:144110826-144110848 AGATGTTGAATTTTATCAAATGG - Intergenic
998688642 5:144560247-144560269 GGGTGTTGAATGTTATCAAAGGG - Intergenic
998724686 5:144996935-144996957 CGTTGTCGAATTTTGTCAAAGGG - Intergenic
999581508 5:153043606-153043628 GGGTTTTGAATTTTATCAAAGGG + Intergenic
1000355846 5:160394582-160394604 GGGTAATAAATTTCATCAAAGGG - Exonic
1000572570 5:162933722-162933744 GAATGTTGAATTTTATAAAATGG + Intergenic
1001375844 5:171257341-171257363 GGATGCTGGATTTTATCAAATGG - Intronic
1001478820 5:172072185-172072207 AGGTGTTGAATTTTATCAAATGG - Intronic
1002380020 5:178820340-178820362 GGATGTTGCATTTTATCAAAAGG + Intergenic
1002703036 5:181140709-181140731 GGGTGTTGAATGTCACTAAATGG + Intergenic
1005178269 6:23072937-23072959 TGTTGTTGAATTTTATGAAAAGG + Intergenic
1005197644 6:23307915-23307937 GGTTTGTGATTTTCAGCAAATGG + Intergenic
1005346651 6:24897151-24897173 GGGTGTTGAGTCTAATCAAATGG + Intronic
1005545622 6:26866692-26866714 TGTTGTTGATTATCATCCAAAGG + Intergenic
1005922331 6:30413815-30413837 GAATGTTGAATTTTATCAAAAGG - Intergenic
1005966898 6:30732948-30732970 GGAGGTTGAGTTTCACCAAAAGG - Intronic
1006838665 6:37014562-37014584 GGTCCTTGAAGTTCAACAAAGGG - Intronic
1007150535 6:39686098-39686120 TTTTGTTTATTTTCATCAAAAGG - Intronic
1007852460 6:44817273-44817295 GGATGTTGAATTTTATCAAATGG - Intronic
1007954810 6:45907238-45907260 GGATGTTGAATTTTATCCAAAGG + Intronic
1008108784 6:47469930-47469952 TAATGTTGAATTTTATCAAATGG - Intergenic
1008243915 6:49147321-49147343 GGATGTTGAATTTTATCAAAGGG + Intergenic
1008314012 6:50016644-50016666 GGCTGAAGAACTTCATCAAAAGG + Intronic
1008411889 6:51189879-51189901 CGTTGTTGAATTTTGTCAAAGGG + Intergenic
1008727210 6:54436736-54436758 CAATGTTGAATTTTATCAAATGG + Intergenic
1009016327 6:57907461-57907483 TGTTGTTGATTATCATCCAAAGG + Intergenic
1009373180 6:62934081-62934103 GGATGTTGAATTTTGTCAAACGG + Intergenic
1009484626 6:64204781-64204803 ATTTGTTGAAATTCATCTAATGG + Intronic
1010314148 6:74425919-74425941 GGATGTTTAATTCTATCAAATGG - Intergenic
1010338408 6:74717866-74717888 GGGTGTTGAATTTTGTCATATGG + Intergenic
1011320260 6:86083656-86083678 AGATGTTGAATTTTATCAAAAGG + Intergenic
1011520825 6:88203743-88203765 GGATGCTGAATTTTATTAAATGG - Intergenic
1011916657 6:92514268-92514290 GTATGTTGAATTTTATCAAAGGG - Intergenic
1011937203 6:92795050-92795072 AGGTGTTGAATTTTGTCAAATGG + Intergenic
1012129727 6:95475363-95475385 GGCTGTTGAATTTTGTCAAAGGG - Intergenic
1012353207 6:98278973-98278995 GGATTTTGACTTTCATCTAATGG + Intergenic
1012640756 6:101609558-101609580 TGTTGTAGAAATTGATCAAATGG - Intronic
1012830337 6:104196688-104196710 AGATGTTGAATTTTATCAAAAGG - Intergenic
1012870449 6:104667092-104667114 GGATGTTGAATTTTATCAAAGGG - Intergenic
1013057622 6:106599519-106599541 TGTTCTTGAATGTCATTAAATGG + Intronic
1013691079 6:112644616-112644638 GGCTATTAAATTTTATCAAAAGG + Intergenic
1013885974 6:114967629-114967651 GCTATTGGAATTTCATCAAAAGG - Intergenic
1014334995 6:120122326-120122348 GGATGTTGGATTTTATTAAAAGG + Intergenic
1014344511 6:120251149-120251171 GGGTGTTGAATTTTATCGAAAGG - Intergenic
1014578570 6:123105893-123105915 GGATGTTGAATTTTAACAAAAGG + Intergenic
1014652031 6:124051740-124051762 AATTGGTGAAGTTCATCAAAGGG + Intronic
1014847193 6:126292144-126292166 GGTTTTAGAAATTCATCATAAGG + Intergenic
1014958039 6:127646173-127646195 AGATGCTGAATTTTATCAAATGG - Intergenic
1015357993 6:132302945-132302967 GGTAGTTTTCTTTCATCAAATGG + Intronic
1016114793 6:140266679-140266701 GGTTGTTGAATTTATACACATGG + Intergenic
1016423118 6:143905766-143905788 GGGTGTTGAATTTTCTCAAATGG + Intronic
1019943132 7:4306859-4306881 GGTGGTTGAACTTCATAAAATGG + Intergenic
1020534237 7:9374078-9374100 TGCACTTGAATTTCATCAAAAGG + Intergenic
1020562023 7:9740162-9740184 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
1020619926 7:10504869-10504891 GGCTGTTGAATTTTGTCAAAGGG - Intergenic
1020640753 7:10750999-10751021 GGATGTTGAATTTTGTCAAAGGG - Intergenic
1020645318 7:10808112-10808134 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1021943341 7:25701502-25701524 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1024027007 7:45419739-45419761 GTGTCTTGAATTTCATGAAAAGG - Intergenic
1024057599 7:45673019-45673041 GGGTATTGAATTTTGTCAAATGG + Intronic
1024483816 7:49893874-49893896 TGTTGTTTAATTTCAGAAAATGG + Intronic
1024497098 7:50061091-50061113 GGAGGTTGAATTTCATTGAATGG - Intronic
1024745962 7:52406506-52406528 GGTTTTTGAGTTTAATAAAAAGG - Intergenic
1025476926 7:60934516-60934538 CGTCGTTGAATTGAATCAAATGG - Intergenic
1025499419 7:61266636-61266658 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1025514273 7:61612861-61612883 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1025538616 7:62041701-62041723 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1027364008 7:77438336-77438358 GGTTTTGGTTTTTCATCAAAGGG - Intergenic
1027777865 7:82488960-82488982 GCCTGTTGAATTTTGTCAAAGGG + Intergenic
1027792632 7:82652762-82652784 TGTTGTTGAATTTTGTCAAAGGG - Intergenic
1028143380 7:87295649-87295671 GAATGTTGAGTTTTATCAAAAGG - Intergenic
1028885263 7:95925292-95925314 TTTTGATGATTTTCATCAAAAGG - Intronic
1029260489 7:99299340-99299362 GTTTGTTTAATTTCATGACATGG + Intergenic
1030200602 7:106899574-106899596 GGGTGTTGAATTTTATCGAAAGG + Intronic
1030454554 7:109757022-109757044 AGATGTTGAATTTTATCAAAAGG + Intergenic
1030459688 7:109817360-109817382 GATTGTTGAGTTTTATCAAGTGG + Intergenic
1030774437 7:113515893-113515915 GAGTGTTGAATTTTATCAAAGGG + Intergenic
1030954303 7:115832116-115832138 GCTTGTTGAAATTTACCAAATGG - Intergenic
1031565574 7:123293168-123293190 GGTTGTTTTTTGTCATCAAAGGG + Intergenic
1031700619 7:124920555-124920577 GTTTTTTGAATTTTATTAAATGG - Intronic
1031862588 7:126998193-126998215 AGATGTTGAATTTTAGCAAAAGG - Intronic
1033709627 7:143928486-143928508 GGTGATTGTATTTCATCAGATGG + Intergenic
1037026300 8:14042373-14042395 GTTTGTTTAAGTTCATCAGAAGG - Intergenic
1037161894 8:15782666-15782688 GGATGTTGAATTCTGTCAAATGG - Intergenic
1037353833 8:17996246-17996268 GGATGTTGAATTTTATCAAATGG + Intronic
1038093725 8:24284171-24284193 CGATGTTGAATTTTATCAAAGGG - Intergenic
1038870278 8:31486310-31486332 GGCTGTTGAATTTTGTCAAAGGG + Intergenic
1039111736 8:34048270-34048292 GGATGTTGGATTTTATCAAAAGG + Intergenic
1039402604 8:37283157-37283179 GGATGATGAATTTTATCAAAGGG - Intergenic
1040390515 8:46946363-46946385 GGCTGTTGACTTTTGTCAAAGGG - Intergenic
1040438686 8:47418829-47418851 GGTTGTTGAATTTTGTCAAAGGG + Intronic
1041563788 8:59251656-59251678 GGATGTCGAATTTTATCAAATGG + Intergenic
1041681615 8:60598696-60598718 GGGTGTTGAATTCTGTCAAATGG - Intronic
1042046126 8:64653918-64653940 GGGTGTTGAATTTTATCAAAAGG - Intronic
1042075232 8:64986704-64986726 GGTTCTTGAATTGTATGAAATGG + Intergenic
1042482644 8:69321914-69321936 GACTGCTGAATTTCATGAAAAGG + Intergenic
1042780273 8:72483227-72483249 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
1043189794 8:77203910-77203932 CGTTGTTGAATTTTGTCAAAGGG + Intergenic
1043521970 8:81056169-81056191 GGCTGTTGAATTTTGTCAAAGGG + Intronic
1044771204 8:95636477-95636499 GGATATTGAATTTTATCAAAAGG - Intergenic
1044784028 8:95775757-95775779 GTTTGTTGACTTTTATCAAAAGG - Intergenic
1044927231 8:97219660-97219682 CTTTGCTGAATTTCAGCAAATGG + Intergenic
1045979677 8:108170177-108170199 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
1046109600 8:109706454-109706476 TGTTTTTGAATTTCATAAAATGG + Intergenic
1046815413 8:118577829-118577851 GGGTGCTGAATTTCCTCACATGG - Intronic
1047130453 8:122014278-122014300 GGTTGTTTAATTCCATGTAATGG - Intergenic
1047154657 8:122303407-122303429 GTTTGTTGAGTCTCATCAACAGG + Intergenic
1048079861 8:131114349-131114371 GGATGCTGAATTTTATCACAGGG + Intergenic
1048145903 8:131843065-131843087 GATTGATGAATTTCATAATAGGG + Intergenic
1048828308 8:138451366-138451388 GGTTCTTGGATTTTAGCAAAGGG + Intronic
1049499550 8:142954479-142954501 AGTTGTGGATATTCATCAAATGG - Intergenic
1050760716 9:9066906-9066928 TGTTGTTTTAATTCATCAAAAGG + Intronic
1051235612 9:14995515-14995537 AGTTTTTGAAATTCATAAAAAGG + Intergenic
1051456012 9:17259185-17259207 GGTTGTTGAATTTTGTACAAAGG + Intronic
1051570045 9:18545701-18545723 AGTTTCTGAATTTCATAAAAAGG + Intronic
1051591654 9:18782170-18782192 GGACTTTGAATTTCATCAACAGG - Intronic
1051603681 9:18898732-18898754 TGATGTTGAATTTTATTAAAGGG - Intronic
1051837330 9:21355463-21355485 GGATATTGAATTTTATCAAATGG - Intergenic
1052103722 9:24484333-24484355 TGAGGTTGAATTTTATCAAATGG + Intergenic
1052662497 9:31452950-31452972 GTTTTTTGAAATTCATTAAATGG + Intergenic
1055356664 9:75444456-75444478 GGGTGTCGAATTTTATCAAAAGG + Intergenic
1055886150 9:81065271-81065293 CAGTGTTGAATTTTATCAAATGG + Intergenic
1056071049 9:82987130-82987152 GGTTGTAAAACTTCAACAAATGG + Intronic
1056375051 9:86000107-86000129 GGATGTTAAATTTTATCAGAAGG + Intronic
1058406327 9:104679161-104679183 AGATGTTGAATTTTATAAAATGG - Intergenic
1059300840 9:113311955-113311977 GCTTGCTGAATTTCATAAACTGG - Intergenic
1059675363 9:116533572-116533594 CGCTGTTGAATTTTGTCAAATGG + Intronic
1059779453 9:117510903-117510925 AGTTGTTGAATTGAATTAAATGG + Intergenic
1060298053 9:122356323-122356345 GGTGGATGACTGTCATCAAAGGG + Intergenic
1062654122 9:137593395-137593417 GGTTGTTGACATTCATCACATGG + Intergenic
1203718957 Un_KI270742v1:185785-185807 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1203653192 Un_KI270751v1:149460-149482 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1186212615 X:7265609-7265631 GGTTATTGAATTACAACAAAAGG + Intronic
1186765304 X:12764490-12764512 GGCTGTTGAATTTTGTCAAAGGG - Intergenic
1187787036 X:22903356-22903378 GAATGTTGAAATTCGTCAAATGG + Intergenic
1187803994 X:23097983-23098005 AGATGTTGGATTTCATTAAAAGG - Intergenic
1188998936 X:36922417-36922439 TTTTGTTGAGTTTCCTCAAATGG + Intergenic
1190592475 X:52018872-52018894 GGATGTTGAACTTTGTCAAATGG - Intergenic
1190893542 X:54592833-54592855 AGATGTTGAATTTTATCAAATGG + Intergenic
1190902571 X:54692426-54692448 GGATGTTGAATTTTATCAAAAGG - Intergenic
1191651479 X:63542857-63542879 CGATGTTGAATTTCATCAAAGGG - Intergenic
1191832007 X:65425672-65425694 GGATGTTGAATTTTATCAAAAGG + Intronic
1191877959 X:65815433-65815455 GGATGTTGAATTTTATCAAAAGG - Intergenic
1192092855 X:68179108-68179130 GTTTGGTTAATTTCTTCAAAGGG + Intronic
1192671422 X:73146498-73146520 TGATGCTAAATTTCATCAAATGG + Intergenic
1192821292 X:74648425-74648447 GGATGTTGAATTCTATCAAATGG + Intergenic
1193171722 X:78345062-78345084 TGGTGTTAAATTTTATCAAAAGG - Intergenic
1193301992 X:79900270-79900292 GGGTGTTGAATTTTATCAGAAGG - Intergenic
1193557795 X:82977514-82977536 GGATGTTGAATTTTATGGAAAGG - Intergenic
1193749111 X:85321372-85321394 TGTTGTTGAATTTTGTCAAAGGG - Intronic
1193953724 X:87831913-87831935 GAATGTTGAATTTTATAAAATGG + Intergenic
1194266235 X:91756592-91756614 CATTGTTGAATTTTGTCAAAGGG - Intergenic
1194285299 X:92003101-92003123 GGATGTTGAATTCTATCAAATGG + Intronic
1194518115 X:94883851-94883873 GGGTATTGAATTTCATCAAATGG + Intergenic
1195305728 X:103581672-103581694 GGATACTGAATTTTATCAAAGGG - Intronic
1197077742 X:122373763-122373785 GGATGTTGAAATTTATCAAATGG + Intergenic
1197670192 X:129268515-129268537 GGATGTTGAGTTTTATCAAATGG + Intergenic
1197876839 X:131117579-131117601 TATTCTTGAATTTCATTAAATGG + Intergenic
1197921453 X:131598897-131598919 GGTTGTTGAATTCCAGAGAAGGG - Intergenic
1198563270 X:137876126-137876148 AGATGTTTAATTTTATCAAATGG - Intergenic
1199645983 X:149912388-149912410 GGATGTTGAATTTTGTGAAATGG - Intergenic
1199789891 X:151143102-151143124 GGCTGTTGAATTTTGTCAGAGGG + Intergenic
1200602868 Y:5227643-5227665 GGATGTTGAATTCTATCAAATGG + Intronic
1200704767 Y:6432847-6432869 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1201029344 Y:9731861-9731883 GGTTGTTGAATTTTGTCAAAGGG - Intergenic
1201173112 Y:11290627-11290649 GGTTGTTGAATTTTGTCAAAGGG + Intergenic
1201186155 Y:11404910-11404932 GTTTGCTGAATTTTGTCAAAGGG + Intergenic
1201853602 Y:18516545-18516567 GGTTGTTCCATTTCAATAAAGGG - Intergenic
1201879719 Y:18803839-18803861 GGTTGTTCCATTTCAATAAAGGG + Intronic
1201913908 Y:19161925-19161947 GGCTGTTGAATTTTGTCAAAGGG - Intergenic
1202173933 Y:22080139-22080161 GGTTGTTCCATTTCAATAAAGGG + Intronic
1202217427 Y:22506243-22506265 GGTTGTTCCATTTCAATAAAGGG - Intronic
1202325759 Y:23689816-23689838 GGTTGTTCCATTTCAATAAAGGG + Intergenic
1202545012 Y:25980238-25980260 GGTTGTTCCATTTCAATAAAGGG - Intergenic
1202577514 Y:26343457-26343479 CATTGTTGAATTTTGTCAAAAGG - Intergenic