ID: 945151196

View in Genome Browser
Species Human (GRCh38)
Location 2:206793793-206793815
Sequence TTGTGTCAATGAAAGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1028
Summary {0: 1, 1: 1, 2: 6, 3: 64, 4: 956}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945151195_945151196 18 Left 945151195 2:206793752-206793774 CCTCTTTTACTAGCATTCTAGTG 0: 1
1: 0
2: 1
3: 7
4: 113
Right 945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG 0: 1
1: 1
2: 6
3: 64
4: 956
945151194_945151196 19 Left 945151194 2:206793751-206793773 CCCTCTTTTACTAGCATTCTAGT 0: 1
1: 0
2: 1
3: 14
4: 206
Right 945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG 0: 1
1: 1
2: 6
3: 64
4: 956

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945151196 Original CRISPR TTGTGTCAATGAAAGAAAAA TGG Intergenic
900719017 1:4163121-4163143 TTGTGTCAAGAAAGAAAAAAGGG - Intergenic
901354619 1:8633920-8633942 CTCTGTCAAAGAAAGAAAAGAGG + Intronic
901619332 1:10570241-10570263 TTGCATCAATGAAACAAGAATGG - Intronic
901900205 1:12354614-12354636 ATGTAGCAATGTAAGAAAAAAGG - Intronic
902388592 1:16089816-16089838 CTCTGTCAAAGAAAGAAAGAAGG + Intergenic
902451090 1:16497720-16497742 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
902568621 1:17332248-17332270 TTGTCTCAAAAAAATAAAAAAGG - Intronic
902584537 1:17430482-17430504 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
903089820 1:20903204-20903226 ATGTGTAAATGAAAGAAGCAAGG - Intronic
903247560 1:22027021-22027043 TTGTCTCAAAAAAAAAAAAAAGG + Intergenic
903619384 1:24686838-24686860 TTGTCTGAAAGAAAAAAAAAAGG - Intergenic
904519279 1:31081984-31082006 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
904649335 1:31992639-31992661 TAGTATAAATAAAAGAAAAAAGG - Intergenic
905030482 1:34880054-34880076 TTGTGTCAAAGAAAGAAAAGGGG - Intronic
906762163 1:48385625-48385647 TTGTGTCTATGAAATGAATAGGG + Intronic
907826761 1:58025094-58025116 GTGTGTGAAAGAGAGAAAAAGGG - Intronic
908052087 1:60244381-60244403 TTGTTTGAATTAAAGAATAAAGG + Intergenic
908073356 1:60488468-60488490 TTGTGTCAGGTAAAGAAAACGGG - Intergenic
908311851 1:62892037-62892059 TTCTGTCAAGGCAAGAAAAAAGG - Intergenic
908491514 1:64648964-64648986 TTCTGTCAAGGAAGGAGAAAGGG - Intronic
909077853 1:71074453-71074475 TTGTGACAATGGAAAAAAAGCGG + Intronic
909176583 1:72369544-72369566 AAGTGTAAGTGAAAGAAAAAAGG - Intergenic
909281525 1:73761000-73761022 TTTCGTCATTGAAAGAGAAAAGG + Intergenic
909316545 1:74226905-74226927 AAATGTCAATGAAACAAAAAGGG + Intronic
909319831 1:74270430-74270452 TAGAGCCAATGAAAGAAGAAAGG + Intronic
909344301 1:74567625-74567647 TAATGTCAATCAAAGAACAAAGG - Intergenic
909534738 1:76723956-76723978 TTGTATTAAAAAAAGAAAAAAGG - Intergenic
910026901 1:82666239-82666261 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
910090963 1:83463641-83463663 TTGTTTCTATGGAAAAAAAAAGG - Intergenic
910144350 1:84062027-84062049 GCTTGTCAATGAAAAAAAAAAGG + Intergenic
910208269 1:84769412-84769434 TTGGGCCAATGAAATATAAATGG - Intergenic
910386276 1:86686200-86686222 TTGTGTAAAGGAAAGTGAAATGG + Intergenic
910441852 1:87261191-87261213 TTGTGCCTGTTAAAGAAAAAGGG - Intergenic
910712147 1:90193218-90193240 TTGTGACAGAGAAGGAAAAAGGG + Intergenic
910943711 1:92565167-92565189 TTGTCTCCATGAAAGGAAACTGG - Intronic
911007052 1:93237241-93237263 ATCTGTCAATGGAAGAAAGAAGG - Intronic
911435744 1:97855431-97855453 TTGTCTCATTCAAAAAAAAATGG + Intronic
911436342 1:97864233-97864255 TTGATTAATTGAAAGAAAAAAGG + Intronic
911454573 1:98107173-98107195 TTGGGTCAAATAAAGAAAATGGG - Intergenic
911459710 1:98174013-98174035 CTGAGTCAATGAAAGGAAATGGG - Intergenic
911586144 1:99693145-99693167 TTGTCTCATGGAAAGTAAAATGG - Intronic
911587627 1:99709169-99709191 TTGTGTCAATGAACAAGAAAAGG + Intronic
912147575 1:106811764-106811786 ATGTGTTAATGAATCAAAAAAGG + Intergenic
912617735 1:111122565-111122587 TTGTCTCCATAAAAGAAAAGGGG + Intronic
912642790 1:111363070-111363092 TTTTGTCAAGGAAGTAAAAAAGG - Intergenic
912674375 1:111663723-111663745 TTTATTGAATGAAAGAAAAAAGG - Intronic
912778283 1:112520816-112520838 TGGTGCAAAGGAAAGAAAAAAGG - Exonic
914079925 1:144400040-144400062 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
914174829 1:145268575-145268597 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
914373854 1:147054600-147054622 GTGTGTAATAGAAAGAAAAAAGG + Intergenic
914529557 1:148510054-148510076 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
915042133 1:152977453-152977475 TTCTTCCTATGAAAGAAAAAGGG - Intergenic
915174632 1:154004649-154004671 CTGTCTCAAAGAAAGAAAAGAGG - Intronic
915777867 1:158510887-158510909 CTGTCTCAAAAAAAGAAAAATGG - Intergenic
915989563 1:160500306-160500328 TTAGGTCAAAGAAAGAGAAATGG - Intronic
916232100 1:162550528-162550550 TTTTCTCAATGAAAGAAGCAAGG + Intergenic
916385227 1:164259692-164259714 ATATGTCTATGAAAGAAAGAAGG + Intergenic
916404053 1:164479803-164479825 TTAGGTCAATAAAAGACAAAGGG - Intergenic
916624954 1:166545564-166545586 TTTTTTAAATGAAAGAACAAAGG - Intergenic
917030098 1:170680943-170680965 ATGTATCAATGAAACAACAAAGG + Intronic
917034396 1:170731220-170731242 TTTTGTCAGTGCAAGAACAACGG - Intronic
918133726 1:181651319-181651341 TGGTCTGAAAGAAAGAAAAATGG - Exonic
918869012 1:189942295-189942317 TTGTATAAATGAAAGAAACTTGG + Intergenic
919053906 1:192544861-192544883 TTTTGTCAATTGATGAAAAAAGG + Intergenic
919185568 1:194143293-194143315 TTAGGTCAATGAATAAAAAATGG - Intergenic
919957699 1:202435788-202435810 TTGTGGAAATGAGAGAACAAAGG + Intronic
920165722 1:204034433-204034455 TTGTCTCAATAAAAAAAAGAAGG - Intergenic
920384590 1:205561411-205561433 CTGTGTCAACCAAAGATAAAAGG + Intergenic
920463155 1:206157798-206157820 TTGTTTGAATGAAATAATAAAGG + Intergenic
920626498 1:207606800-207606822 TTGTATAAAAGAAAGAACAATGG - Intronic
920684673 1:208100349-208100371 TTATCTCAAAGAAAAAAAAAAGG + Intronic
920795231 1:209130593-209130615 GTGTGTGTATGAAAGGAAAAGGG - Intergenic
921231463 1:213076871-213076893 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
921233124 1:213094048-213094070 TTTTGTCAATTTAAAAAAAATGG - Intronic
921453894 1:215343461-215343483 CTGAGTCAATGAAGTAAAAAAGG + Intergenic
921504059 1:215944725-215944747 TTGCTTAAATGAAAGAAATATGG + Intronic
921555356 1:216592229-216592251 TTGTGTCAATGAAATTAAACTGG + Intronic
921800553 1:219398166-219398188 TTGTGTCCCTGAAAGAGATAAGG - Intergenic
922135312 1:222819418-222819440 TTATGTCAAAGAATGGAAAATGG + Intergenic
922465404 1:225842999-225843021 GTGTGTCACTGAAGGAATAAAGG - Intronic
922680636 1:227592471-227592493 ATGTGTCAGAAAAAGAAAAATGG - Intronic
923375784 1:233361128-233361150 TTATGGAAATGAAATAAAAATGG + Intronic
923439857 1:234006990-234007012 TTGTGACAAAGAACAAAAAATGG - Intronic
923718889 1:236450551-236450573 CTGTCTCAAAGAAAAAAAAAGGG - Intronic
924088758 1:240481210-240481232 TTCTGGCAATGAACAAAAAAAGG + Intergenic
924544625 1:245015120-245015142 TTGTCTCAAAGAAAAGAAAAAGG - Intronic
924786376 1:247203677-247203699 TGGTTTCAATGAAAAACAAAGGG + Intergenic
1064484846 10:15775600-15775622 TTGTGAGAATAAAAGATAAACGG - Intergenic
1064608569 10:17072355-17072377 TTTTGCCATTGAAAGAAAAAAGG + Intronic
1064763006 10:18641368-18641390 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
1065797568 10:29321300-29321322 TTGTGTCACTGACAGGAAAGGGG + Intergenic
1065800555 10:29347772-29347794 TTTTGTAAAGGAAAGCAAAATGG - Intergenic
1065877262 10:30008141-30008163 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
1066472639 10:35714052-35714074 TTCTGTCACTGAAAGGAAGAAGG - Intergenic
1066655250 10:37693044-37693066 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1067799570 10:49349747-49349769 TGGTGTCAATCATAGGAAAAGGG + Intergenic
1067839279 10:49663223-49663245 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1068383929 10:56298767-56298789 TTGGGACAAAGAAAGAAACACGG - Intergenic
1068470255 10:57452419-57452441 TTATGTGACTGACAGAAAAATGG - Intergenic
1068647405 10:59482883-59482905 TAGTGTCAATCAAAGGGAAAAGG + Intergenic
1068724839 10:60289414-60289436 TTGTCTCAAAAAAAGAAAGAAGG - Intronic
1068877725 10:62014963-62014985 TTCCATCAATGAAACAAAAAAGG + Intronic
1069085792 10:64138228-64138250 TTGGGTGAGTGAAAGGAAAAGGG + Intergenic
1069291337 10:66784536-66784558 ATCTGGCAATGGAAGAAAAAAGG - Intronic
1069295092 10:66834037-66834059 GTGTGTCATTGAAAGAACATGGG - Intronic
1069543641 10:69313947-69313969 TTGGGCAAATGAAAGAGAAAAGG + Intronic
1069916949 10:71792903-71792925 TTGTATAATTGACAGAAAAATGG + Intronic
1070239214 10:74661025-74661047 CTGTCTCAAAGAAAAAAAAAAGG + Intronic
1070253625 10:74795440-74795462 TTGTCTCAAAAAAAAAAAAAGGG - Intergenic
1070817268 10:79332547-79332569 TTGTCTCAAGGGAACAAAAAAGG + Intergenic
1070818191 10:79338514-79338536 TTGTCTCAAGGGAACAAAAAAGG - Intergenic
1071261813 10:83926927-83926949 TCCTGTCAAAGAAGGAAAAAGGG + Intergenic
1071739460 10:88340653-88340675 TTGTAGAAATAAAAGAAAAAAGG + Intronic
1072098605 10:92207282-92207304 GTATGTACATGAAAGAAAAATGG - Intronic
1072204414 10:93190028-93190050 TTCTTTAAATGAAAGAAAAATGG - Intergenic
1072303250 10:94082675-94082697 TTCTGTCAATGAAAGCCAATGGG + Intronic
1072629770 10:97137588-97137610 TTGTCTAAAAGAAAGAAAGAAGG - Intronic
1072669429 10:97418563-97418585 TTATGTGAATGAAAGCAGAAGGG + Intronic
1072919170 10:99561074-99561096 TTGGGTCAAAGCAAGGAAAACGG - Intergenic
1072941327 10:99766842-99766864 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
1073018815 10:100423775-100423797 TTGTGGCAATTCAGGAAAAAAGG - Intergenic
1073383961 10:103106998-103107020 CTGTGGGAATGAAAGAATAAAGG - Intronic
1073640097 10:105243682-105243704 TTTGGTAAATGAAAGAAGAAAGG - Intronic
1073924436 10:108498713-108498735 TTTTTTCAATGAAGAAAAAATGG + Intergenic
1074111998 10:110429331-110429353 TGGTGAAGATGAAAGAAAAAGGG - Intergenic
1074147209 10:110727190-110727212 ATGTGTCAACTAAAGATAAAAGG - Intronic
1074342982 10:112652720-112652742 TTGTCTCAAAAAAAAAAAAATGG + Intronic
1074530395 10:114293579-114293601 TCTTTTAAATGAAAGAAAAAAGG - Intergenic
1074862017 10:117517508-117517530 GTGTGTCAATGAAACAAACAGGG - Intergenic
1075115869 10:119626813-119626835 ATGGGGCAAAGAAAGAAAAATGG + Intergenic
1075247413 10:120835635-120835657 AAGTGTCAAAGAAAGACAAAAGG + Intergenic
1075363381 10:121860493-121860515 ATGTTTCCATGAAAGCAAAAAGG + Intronic
1075754461 10:124800202-124800224 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
1076282358 10:129259028-129259050 TTGTGCCAAAGATAGAAGAACGG - Intergenic
1077508981 11:2945645-2945667 TTCTGTCAATGAAAAAGACAAGG + Exonic
1078179271 11:8997071-8997093 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1078384898 11:10881182-10881204 GTGTGTTTATGAAAGAAAAGCGG - Intergenic
1078666224 11:13327588-13327610 TTCAGTCAATGACAGAAAAGAGG - Intronic
1078940504 11:15999413-15999435 TTTTATCAATAATAGAAAAAAGG + Intronic
1079235629 11:18687407-18687429 CTGTCTCAATTAAAAAAAAAAGG + Intergenic
1079671036 11:23171564-23171586 TTGTGTCTAAGAAAGAAATGTGG - Intergenic
1079803487 11:24899175-24899197 TGGTGTAAATGAATCAAAAAAGG - Intronic
1079899564 11:26164986-26165008 ATGGGTCAATGAAAGAGGAAAGG + Intergenic
1079960358 11:26916139-26916161 ATGTGTGAATGTAAGAATAATGG + Intergenic
1080112961 11:28589704-28589726 TTGTTTAAATAAAAAAAAAAAGG + Intergenic
1080168349 11:29267940-29267962 TTGTGTAAATCATGGAAAAAAGG + Intergenic
1080558223 11:33436977-33436999 TTGTGTTTGTGAAAGGAAAAAGG + Intergenic
1080565007 11:33499990-33500012 TGGTATCAGTGAAAGAAGAAGGG - Intergenic
1081165377 11:39802218-39802240 GTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1081170277 11:39859922-39859944 TTGTGTTAAGGAATAAAAAAAGG + Intergenic
1081278028 11:41174865-41174887 TTAAGACTATGAAAGAAAAATGG - Intronic
1081474128 11:43408744-43408766 CTGTCTCAAAGAAAAAAAAAAGG - Intronic
1081475458 11:43425685-43425707 TACTAACAATGAAAGAAAAAAGG - Intronic
1082071066 11:47940024-47940046 TTGTCTCAAAAAAAAAAAAAGGG + Intergenic
1082098949 11:48155778-48155800 CTGTGACATTAAAAGAAAAAAGG - Intronic
1082240360 11:49863202-49863224 TTTTGACAATGAAAGCAGAAGGG - Intergenic
1082622635 11:55442566-55442588 TGGTAAAAATGAAAGAAAAAGGG - Intergenic
1083013053 11:59422470-59422492 ATGTTTCAATGAAAGAACTAAGG + Exonic
1083913735 11:65726651-65726673 TTGTGTTAATGACACAAAAGTGG + Intergenic
1084365426 11:68694415-68694437 TTATTTCAATGCAAAAAAAAAGG + Intergenic
1085427987 11:76421898-76421920 TTGTCTCAAAAAAAAAAAAAGGG + Intergenic
1086466970 11:87064261-87064283 TTGTGTAAAAAAAAAAAAAAAGG - Intronic
1086535682 11:87842292-87842314 CTGTGTCACTGAGAGACAAAAGG + Intergenic
1086839084 11:91662662-91662684 CTGTATCACTGTAAGAAAAAAGG + Intergenic
1087548877 11:99620975-99620997 TTGTTTGAATGAAAAAAAATAGG - Intronic
1089182327 11:116591542-116591564 TGCTGAGAATGAAAGAAAAAAGG - Intergenic
1089543238 11:119203719-119203741 CTGTTTCAAAGAAAAAAAAAAGG + Intergenic
1089828903 11:121307162-121307184 TTGTGTAATGGAAAGATAAAAGG - Exonic
1089941000 11:122417507-122417529 TTCTGTCAATTAAAGTAATAAGG - Intergenic
1090723614 11:129500206-129500228 TTGTCTCAAAAAAAAAAAAAAGG + Intergenic
1090932199 11:131308147-131308169 CTGTCTCAAAGAAAAAAAAACGG - Intergenic
1091351452 11:134900538-134900560 TTGTGAAAATCAAAGAAAATCGG - Intergenic
1092268133 12:6999391-6999413 CTGTGAGAAAGAAAGAAAAAGGG + Intronic
1092307476 12:7316243-7316265 TTGGGTCAATGAAATTAACATGG + Intronic
1092601421 12:10070536-10070558 ATGGGTCAATGGAAGAAAATAGG + Exonic
1092665206 12:10788981-10789003 TAATGAAAATGAAAGAAAAATGG + Intergenic
1092674947 12:10905659-10905681 CTGTCTCAAAGAAAAAAAAATGG + Intronic
1092698889 12:11204867-11204889 TTCTGTCAAAAAAAGAAAAAAGG + Intergenic
1092756383 12:11767104-11767126 TTAAGTTAATGAAATAAAAAAGG + Intronic
1093370910 12:18363978-18364000 TTGATTCTATGAAAGAAAAAGGG - Intronic
1093398901 12:18718532-18718554 ATGTTTAAATGAGAGAAAAATGG - Intronic
1093765112 12:22953450-22953472 TTGTGTCACAGAAATAAAATAGG + Intergenic
1094748786 12:33380389-33380411 TAGAGTCAATTAAAGAAAATTGG - Intronic
1094758850 12:33504150-33504172 TTGGGTCATAGAAATAAAAAAGG - Intergenic
1095272885 12:40241201-40241223 CTCTGTCAATGAAACACAAACGG - Intronic
1095284477 12:40391959-40391981 GTGAATCATTGAAAGAAAAAAGG + Intergenic
1095304439 12:40622962-40622984 TTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1095505408 12:42892051-42892073 TTGTTTTAATTAAAGAAAAGAGG - Intergenic
1096127937 12:49133694-49133716 GTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1096366888 12:51035668-51035690 TTGTTTCAATGTAGAAAAAAAGG - Intergenic
1096404607 12:51334436-51334458 CTGTCTCAAAGAAAAAAAAAAGG - Intronic
1096690613 12:53319199-53319221 TTGTCTCAAAAAAAAAAAAAGGG - Intronic
1096694988 12:53343181-53343203 TTGTCTAAAAGAAAAAAAAAAGG + Intronic
1097622520 12:61957839-61957861 TTGTGTCCAGGAAAGAAATAAGG - Intronic
1097692540 12:62746954-62746976 CTGTCTCAAAAAAAGAAAAAAGG - Intronic
1097881523 12:64690838-64690860 TTTTTTAAATGAAAAAAAAAAGG - Intronic
1097951346 12:65432365-65432387 TTGTGGCAAGGAAAGATGAATGG + Intronic
1098143523 12:67475011-67475033 TTTTTTAAAAGAAAGAAAAATGG + Intergenic
1098599545 12:72314566-72314588 CAGTGTCACTGAAGGAAAAATGG + Intronic
1098878201 12:75889179-75889201 TTGTTTCAAAGAAAGTAACAGGG - Intergenic
1098977290 12:76916238-76916260 TTATGTCAAAAAAAAAAAAATGG - Intergenic
1099135612 12:78895886-78895908 TTGTGTAGAAGAAAGAAAAATGG + Intronic
1099416863 12:82399942-82399964 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1099964319 12:89429194-89429216 ATATGGAAATGAAAGAAAAAAGG + Intronic
1100816169 12:98389253-98389275 TTGCCTCCATTAAAGAAAAATGG - Intergenic
1101538816 12:105645682-105645704 TTGTGACAATTAAATTAAAAAGG + Intergenic
1101732511 12:107438261-107438283 ATCTGTCAATGCATGAAAAAAGG - Intronic
1101946435 12:109140650-109140672 TTGTCTCAAAAAAGGAAAAAAGG + Intronic
1102075409 12:110056098-110056120 CTGTGTCAAAGAAAAAAAAGAGG + Intronic
1102235027 12:111289116-111289138 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1102313459 12:111865910-111865932 GTGGGTCAATGAAAAAATAATGG - Intronic
1102593834 12:113977396-113977418 TTGTGAAAATGAAAAAAGAAGGG + Intergenic
1102717212 12:114984595-114984617 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1102942029 12:116951536-116951558 TTGTGCAAAAGAAAGAGAAAAGG - Intronic
1103143130 12:118569139-118569161 TGGTCCAAATGAAAGAAAAAAGG - Intergenic
1103176770 12:118870962-118870984 ATCTGTCAAAGAAAGAATAAGGG - Intergenic
1103207014 12:119137845-119137867 TTTTGTCAATGAAAGGAACCAGG - Intronic
1103667498 12:122581497-122581519 TTGTCTCAAAAAAAGAAAAAAGG - Intronic
1103710211 12:122907035-122907057 TTGTGTCACTATAATAAAAAAGG - Intergenic
1104044515 12:125152401-125152423 TTGTGGCAGTTAAAGAAAAACGG + Intergenic
1104806682 12:131593831-131593853 TAGTGTCCTTAAAAGAAAAATGG - Intergenic
1104881374 12:132073458-132073480 CTGTGTCAAAAAAAAAAAAAAGG - Intronic
1105323645 13:19350756-19350778 TTGTGAAAAAGAAAAAAAAAAGG - Intergenic
1106205419 13:27589029-27589051 TGGATTCAATGAAAGAAAAGGGG + Intronic
1106543338 13:30709825-30709847 TCTGGTCAATGAAAGATAAATGG - Intergenic
1106638623 13:31559015-31559037 TTGTGGGAATGCAATAAAAATGG + Intergenic
1106757179 13:32834351-32834373 ATTTGTCAATGATAGAAAAAAGG - Intergenic
1107023052 13:35771673-35771695 ATGTGTCAGTAAAAGAAAGACGG + Exonic
1107129138 13:36876696-36876718 ATGTGTGAATGAAAAGAAAATGG + Intronic
1107511479 13:41090257-41090279 TTCTCTCAAAGAAAAAAAAAAGG - Intergenic
1107560657 13:41554281-41554303 TTCTGAGAATGAAAGGAAAAAGG - Intergenic
1108096666 13:46908902-46908924 TAGTGTCATTGAAAGGAGAAAGG + Intergenic
1108547249 13:51508240-51508262 CTCTGTCAAAGAAAAAAAAAAGG + Intergenic
1108649192 13:52458851-52458873 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1108870709 13:54981653-54981675 TTGTGTTTATGTATGAAAAATGG + Intergenic
1108974489 13:56421300-56421322 TTATGTCAATTAAAAACAAAAGG - Intergenic
1109020538 13:57085327-57085349 TTGTGTGTATGAAAGGAAAGAGG + Intergenic
1109060759 13:57616258-57616280 TTGTCTCAAACAGAGAAAAAAGG + Intergenic
1109471714 13:62815601-62815623 TTTTGTCAATCAAAGGGAAAAGG + Intergenic
1109648610 13:65294185-65294207 ATGTGTCTGTGAAAAAAAAATGG + Intergenic
1109764790 13:66880667-66880689 TTAGGTCTATGCAAGAAAAAGGG + Intronic
1109847569 13:68016092-68016114 TTGTCTCAAAAAAATAAAAAAGG - Intergenic
1109938300 13:69324554-69324576 TTGTGTCACTGACACACAAATGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110526138 13:76539274-76539296 TTGTATGAATGAAATAGAAAAGG - Intergenic
1110850038 13:80234526-80234548 TTGTGACAATGAAAAAATTAGGG - Intergenic
1111305088 13:86400573-86400595 TTATGTAAAAGGAAGAAAAAGGG + Intergenic
1111422296 13:88028643-88028665 TTGTTTCAAGGACAGACAAATGG - Intergenic
1111441772 13:88291066-88291088 TTGTTTAAATCACAGAAAAAGGG + Intergenic
1111442161 13:88293898-88293920 TTGTTTAAATCACAGAAAAAGGG - Intergenic
1111535637 13:89599267-89599289 TTGTGGTAATAAAACAAAAATGG - Intergenic
1111543005 13:89692816-89692838 CTATGTCAATGAAAGGGAAATGG - Intergenic
1111743466 13:92234545-92234567 TTGAATAAATGAAAGACAAAAGG + Intronic
1111796400 13:92926107-92926129 TTGTGCAAATGAGAGATAAAGGG + Intergenic
1112144702 13:96685772-96685794 CTGGGTCAATGAAGGAAAACGGG - Intronic
1112492066 13:99875803-99875825 TAGTGAAAATGAAAGATAAAGGG + Intronic
1113354552 13:109566152-109566174 ATGAGTCAATTGAAGAAAAAGGG - Intergenic
1113584519 13:111455716-111455738 TTATATAAATGAAAGAATAAAGG - Intergenic
1114343846 14:21774332-21774354 TTGTTTCAAAGAATGAAAATTGG + Intergenic
1114496163 14:23133817-23133839 CTGTCTCAAAGAAAAAAAAAAGG + Intronic
1115015798 14:28612165-28612187 TTGTGTCAATAAAGGTAAAATGG - Intergenic
1115283645 14:31693386-31693408 TAATGTCAAAGGAAGAAAAATGG - Intronic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1115540303 14:34413250-34413272 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1115544385 14:34452312-34452334 TTGTTTCAATGTAAGAAAACTGG - Intronic
1115562319 14:34594307-34594329 TTGTTTCAAAAAAAAAAAAAAGG - Intronic
1116144803 14:41051462-41051484 TTGTGTATTTGAAATAAAAATGG + Intergenic
1116197409 14:41746695-41746717 ATGTGTAAAAGAAAGAAGAAAGG + Intronic
1116368518 14:44100978-44101000 ATGTGTCACAGAAAGAAAAAAGG - Intergenic
1116537600 14:46054287-46054309 TTGTGAAAAAGAAACAAAAAGGG - Intergenic
1116864546 14:50020932-50020954 TTGTGTTAATAAGAAAAAAATGG - Intergenic
1117005976 14:51421502-51421524 TTGTGTCTAGGAAAGAAATCTGG + Intergenic
1117160803 14:52987531-52987553 TTCTGTAAATGAATGAATAAAGG + Intergenic
1117171039 14:53096403-53096425 TGCTGTTACTGAAAGAAAAAAGG + Intronic
1117470067 14:56035545-56035567 TTATATCAATGAAAACAAAATGG - Intergenic
1117590886 14:57267626-57267648 TTGTGTGAAAGAAATGAAAACGG - Intronic
1117605388 14:57423396-57423418 TTGTGTCCAAGAAAGAGAAATGG + Intergenic
1117711355 14:58532175-58532197 ATGTGTAATTGAAAAAAAAAAGG + Intronic
1118170908 14:63387667-63387689 ATTTGTCGAAGAAAGAAAAAAGG - Intronic
1118219579 14:63842462-63842484 CTGTATCAATAAAAAAAAAAAGG - Intergenic
1118594915 14:67427924-67427946 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
1118672324 14:68142980-68143002 CTGTCTCAAGGAAAAAAAAAAGG + Intronic
1118813949 14:69295753-69295775 TGGTTTCGATGAAAGAACAATGG - Intronic
1119403942 14:74384030-74384052 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1120640574 14:87006639-87006661 TTTTGTCAATTAAAAAATAAAGG - Intergenic
1120849237 14:89154593-89154615 TCCTATCAATGAAAAAAAAAAGG + Intronic
1121090476 14:91178169-91178191 TTGTCTCAAAAAAAAAAAAAGGG - Intronic
1121940440 14:98065086-98065108 TTGTGTCCATGAAGTAAGAAGGG + Intergenic
1122570925 14:102700225-102700247 CTGTCTCAAAAAAAGAAAAAGGG - Intronic
1122663508 14:103313244-103313266 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1124580345 15:30948225-30948247 TTGTGTCATTAAAAGATGAAGGG - Intronic
1124587507 15:31023304-31023326 TTGAGGAAATGAAAGAGAAATGG + Intronic
1124938740 15:34198053-34198075 TTGTGTCAAGAAAAGAAACTCGG - Intronic
1125452667 15:39825195-39825217 CTGTTTCAAAAAAAGAAAAAAGG + Intronic
1125868785 15:43078296-43078318 ATGTGGCAATGAAGGAAAAAGGG + Intronic
1126202495 15:46002985-46003007 GTGGGTCAATGTAAGAGAAAAGG - Intergenic
1126524528 15:49636316-49636338 TTGTGTAAAAAAAAAAAAAAAGG + Intronic
1126620348 15:50632808-50632830 TGTTTTGAATGAAAGAAAAATGG + Intronic
1126808998 15:52381904-52381926 TCGTCTCAAAAAAAGAAAAAAGG - Intronic
1127106924 15:55626402-55626424 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1127478777 15:59359123-59359145 TTTGGTCACTGAAAGAAACAAGG + Intronic
1127731858 15:61809091-61809113 CTATTTCAATGAAAGAAAGAGGG - Intergenic
1127887912 15:63219758-63219780 TTTTTTCCATGAAAGAAAACTGG + Intronic
1128261395 15:66235495-66235517 CTGTCTCAAAGAAAAAAAAAAGG + Intronic
1128365999 15:67003522-67003544 TTGTCTCAAAAAAAAAAAAAAGG + Intergenic
1129521499 15:76189312-76189334 TTGTCTCAAAAAAAGAAAGAGGG + Intronic
1129913711 15:79249368-79249390 TTGTCTCAAAAAAATAAAAAAGG - Intergenic
1130655464 15:85789385-85789407 TTCTGTCAAAAAAAAAAAAAGGG - Intronic
1130761262 15:86822535-86822557 TTGTGGTGATGAAAGAAAATGGG + Intronic
1131740720 15:95388009-95388031 TTATGTTAACGAAAGAACAAAGG + Intergenic
1131873094 15:96780375-96780397 TTGTGTCAAGAAAAGAAGGAAGG - Intergenic
1131947295 15:97638572-97638594 TTTTGTCAATGAGATAAAATAGG - Intergenic
1131994135 15:98118414-98118436 CTGTCTCAAGGAAAAAAAAAAGG - Intergenic
1132171294 15:99659014-99659036 TTTGTTGAATGAAAGAAAAAAGG + Intronic
1132650207 16:1017927-1017949 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1132908423 16:2296234-2296256 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
1133290219 16:4715589-4715611 TTGTCTCAAAAAAATAAAAAAGG + Intronic
1133371811 16:5251031-5251053 TAGTGTGAATAAAAGAAAGAGGG - Intergenic
1133981552 16:10636369-10636391 TTGTCTCAAAAAAAAAAAAAGGG + Intronic
1134264088 16:12677634-12677656 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1134744372 16:16576198-16576220 TTGCCTCAATGAAATAAAAGAGG + Intergenic
1135001112 16:18777558-18777580 TTGCCTCAATGAAATAAAAGAGG - Intergenic
1135386446 16:22045178-22045200 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1135602864 16:23798032-23798054 CTGGGTCAAAGAAAGAAAAGAGG + Intergenic
1135912838 16:26577133-26577155 TTGTTTCAAAGGAAGCAAAAAGG - Intergenic
1135940144 16:26815288-26815310 TTGTCTCAAAAAAAAAAAAAAGG + Intergenic
1136558695 16:31025414-31025436 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1137485393 16:48886219-48886241 TTTTAACAATGTAAGAAAAAGGG - Intergenic
1137831409 16:51546647-51546669 TTGTTTCAAGGAGAGAAAGAAGG - Intergenic
1138133910 16:54504865-54504887 TTGTGACAATGAAGGAAAAAGGG + Intergenic
1138327240 16:56184996-56185018 ATGAGGCAATGAAAGAAAAAGGG - Intergenic
1138698063 16:58834176-58834198 TTGTTTCAGTGAAATAAACAGGG - Intergenic
1138742138 16:59323322-59323344 TTGTTGCAATGAAGGAAAAGTGG - Intergenic
1139209496 16:65063423-65063445 GTGTGGAAATGACAGAAAAATGG + Intronic
1139819085 16:69705614-69705636 ATGTTTAAATGAAAGGAAAAAGG + Intergenic
1139903837 16:70348937-70348959 CTGTTTCAAAAAAAGAAAAAAGG + Intronic
1140245082 16:73241030-73241052 TTTTCTCAAAGAAAGAAAACTGG + Intergenic
1140512734 16:75519795-75519817 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
1140750697 16:78020976-78020998 TTGTCTCAAAGAAAAAACAAAGG + Intergenic
1140859583 16:79007223-79007245 TTGTGTGGGTGAAATAAAAAAGG + Intronic
1140942524 16:79735240-79735262 GTGTGTCAAGAAAAGAAAAGTGG - Intergenic
1141118362 16:81331194-81331216 ATGTCTCAAAAAAAGAAAAAAGG + Intronic
1141216585 16:82031021-82031043 TTATTTCAAAGATAGAAAAAAGG + Intergenic
1141467098 16:84213543-84213565 TTGTCTCAAACAAAAAAAAAAGG - Intergenic
1141565374 16:84898094-84898116 TTATTACAGTGAAAGAAAAAAGG - Intronic
1142004599 16:87683609-87683631 CTGTCTCAAGGAAAAAAAAAAGG - Intronic
1142593506 17:1018346-1018368 ATGTGTCAATTAAAAAATAAGGG - Intronic
1143793471 17:9317054-9317076 TTGTGTAGATGAAAGGAATAAGG + Intronic
1143797155 17:9346337-9346359 TTTAGTCAAGGAAAGAGAAATGG - Intronic
1143812372 17:9482358-9482380 TTGTGTGATAGAAATAAAAATGG - Intronic
1143960430 17:10712928-10712950 TTGTGTGAAATAGAGAAAAATGG + Intronic
1144869390 17:18359645-18359667 GTGTCTCAATAAAAAAAAAAAGG + Intronic
1145020636 17:19427772-19427794 GTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1145035040 17:19534696-19534718 TTATGTATGTGAAAGAAAAAAGG + Intronic
1145099417 17:20061739-20061761 TTGAATAAATGAAAGAAAAATGG - Intronic
1145819264 17:27818742-27818764 TTCTGTCAGTGAAAGAGAAAGGG - Intronic
1146248235 17:31310635-31310657 TAGTGTCAGGGAAAAAAAAAGGG - Intronic
1146267375 17:31461720-31461742 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
1146405321 17:32531675-32531697 TTGTGTGCATCAAACAAAAATGG + Intronic
1146474403 17:33151367-33151389 TTGTCTCAAGAAAAAAAAAAAGG + Intronic
1146717020 17:35094972-35094994 TGGAGCCACTGAAAGAAAAATGG - Intronic
1147032727 17:37653467-37653489 TTGTGTAAAAAAAAAAAAAAAGG + Intergenic
1147803048 17:43108329-43108351 TTGTGCCAAAAAAAAAAAAAAGG + Intronic
1148241395 17:46001701-46001723 TTGTCTGAATGAATGAATAAAGG - Intronic
1148989534 17:51653385-51653407 TTCTGTCCTAGAAAGAAAAAGGG - Intronic
1149691585 17:58581540-58581562 TTTTCTCAATAAAAGAAATAAGG + Intronic
1150758237 17:67935421-67935443 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1151123976 17:71825123-71825145 TTGTCTCAAAGAGAGAAACAGGG - Intergenic
1151234134 17:72706295-72706317 TTGTCTAAAGCAAAGAAAAATGG + Intronic
1151635271 17:75343043-75343065 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1151859165 17:76746911-76746933 TTGTCTCAAAAAAAAAAAAATGG - Intronic
1152324738 17:79629002-79629024 TTGAATCAATGAATGAACAAAGG - Intergenic
1152663619 17:81554406-81554428 GTGTGTCAAAAAAAAAAAAAGGG - Intergenic
1153147874 18:2054340-2054362 CTATATCAATGATAGAAAAATGG + Intergenic
1153259140 18:3205991-3206013 TTATGTCAATCAAGGAAGAAAGG + Intronic
1153555938 18:6313380-6313402 TTTTGTATATTAAAGAAAAAGGG - Intronic
1153587441 18:6637654-6637676 TAGTGTCAAAAAAAAAAAAAAGG - Intergenic
1153849586 18:9080646-9080668 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
1154243335 18:12672545-12672567 TTATCACAATGAAAGAAAAAAGG + Intronic
1155082429 18:22424010-22424032 TTGTGCTAATAAAAGAATAAGGG - Intergenic
1155147879 18:23098880-23098902 TAGTGTAAATAAAAAAAAAAAGG + Intergenic
1155277899 18:24207028-24207050 TGGAGCCAAAGAAAGAAAAACGG + Intronic
1156648482 18:39196712-39196734 TTTTGTGAGTCAAAGAAAAAAGG - Intergenic
1156911756 18:42418840-42418862 TTTTGTAAAAGAAAAAAAAAAGG - Intergenic
1157017705 18:43737799-43737821 CTGTGCCAATGAAAGTGAAACGG - Intergenic
1157546991 18:48553659-48553681 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
1157824006 18:50796050-50796072 TTGAATGAAAGAAAGAAAAAAGG - Intronic
1157887449 18:51382845-51382867 TTGTGAAGATGAAAGGAAAAGGG - Intergenic
1158321899 18:56272696-56272718 TTGAGTCAATGAAACAAATTTGG + Intergenic
1158771879 18:60528813-60528835 TAATGGCAAAGAAAGAAAAAAGG - Intergenic
1158938551 18:62385967-62385989 TTTTCTAAAAGAAAGAAAAAAGG + Exonic
1159690767 18:71484188-71484210 TTTTGTCCATGAAAGTACAAAGG - Intergenic
1159792816 18:72804470-72804492 TTTTATAAATGAAAGAAATAGGG + Intronic
1160158872 18:76455923-76455945 TTGTGTTTATTAAAGAATAATGG - Intronic
1160760329 19:780969-780991 TCATCTCACTGAAAGAAAAAGGG + Intergenic
1161848117 19:6724029-6724051 TTGTGACAATTAAAGAAACCAGG + Intronic
1162133271 19:8540359-8540381 TTGTGACAAAGAAAAAATAAAGG - Intronic
1162390149 19:10384907-10384929 CTCTCTCAATAAAAGAAAAAAGG - Intergenic
1162618359 19:11820111-11820133 CTGTGTCTAGGAAAGATAAAAGG - Intronic
1162627091 19:11893525-11893547 CTGTGTCTAGGAAAGATAAAAGG - Intronic
1162631391 19:11929874-11929896 CTGTGTCTAGGAAAGATAAAAGG - Intronic
1162636235 19:11969816-11969838 CTGTGTCTAGGAAAGATAAAAGG - Intronic
1162723035 19:12673715-12673737 TAGTCTCAAAAAAAGAAAAAAGG - Intronic
1163459990 19:17431379-17431401 TTGTCTCAAGAAAAGAGAAATGG - Intronic
1164882475 19:31745032-31745054 CTGTGTCAAAAAAAAAAAAAAGG + Intergenic
1165753288 19:38275029-38275051 TTGTGACATTGAAAGAGCAAAGG + Intronic
1166773624 19:45299408-45299430 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1166815088 19:45539747-45539769 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1166825008 19:45603080-45603102 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1167021756 19:46882136-46882158 TTGTCTCAAAAAAAAAAAAAGGG - Intergenic
1167028139 19:46937243-46937265 TTCTGTCCAGGAAAGAGAAAGGG - Exonic
1167561435 19:50228279-50228301 CTGTGTCAAAAAAAAAAAAAAGG + Intronic
1168259815 19:55187036-55187058 CTGTCTCAAAGAAAAAAAAAAGG + Intronic
1168660710 19:58163763-58163785 ATGAGTCAATGGAAGTAAAAAGG + Intergenic
1202685698 1_KI270712v1_random:47896-47918 TTGTCTCAAAAAAAAAAAAAGGG + Intergenic
925365907 2:3312035-3312057 TTGGGTCAATGAAAGCTATAGGG - Intronic
925764803 2:7222000-7222022 CATTTTCAATGAAAGAAAAATGG + Intergenic
926270268 2:11360493-11360515 CTGTCTCAAGGAAAAAAAAAAGG + Intergenic
926559880 2:14404890-14404912 TAATATTAATGAAAGAAAAATGG + Intergenic
926669916 2:15567070-15567092 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
926811923 2:16763008-16763030 TTGTTTTATTGAAAGATAAATGG + Intergenic
927627921 2:24743184-24743206 TTATATAAATGAAAGAAAAGAGG + Intronic
928708683 2:33980103-33980125 TTTTGTCAGTGAAGGAAACATGG - Intergenic
928825464 2:35415077-35415099 GTGTGTAAAAGAAAGTAAAATGG + Intergenic
928961710 2:36933043-36933065 GTGTGTAAATTAAAAAAAAATGG - Intronic
929038094 2:37715118-37715140 ATTAGTCAATGAAAGAATAAAGG - Intronic
929219147 2:39445415-39445437 TTGTATCAATGAAACAAAAGAGG + Intergenic
930224960 2:48783100-48783122 CTGTCTCAAAGAAAAAAAAATGG - Intergenic
930491377 2:52076639-52076661 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
930515690 2:52405110-52405132 TTGAGAAAATGAGAGAAAAAAGG - Intergenic
930966059 2:57328261-57328283 TTATGTCTATGAAAGAAGATGGG - Intergenic
931078179 2:58739936-58739958 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
931079810 2:58756014-58756036 TTGTATTATTGAAAGAAATATGG + Intergenic
931085330 2:58823766-58823788 TTTTTTTAATGAAGGAAAAAAGG + Intergenic
931120179 2:59208115-59208137 ATGTGTCAATGAAAGAAGGAAGG + Intergenic
931143290 2:59487520-59487542 TTGGGTGGATTAAAGAAAAATGG - Intergenic
931296549 2:60932310-60932332 TTTTGTCAATTAAAAAAAAAAGG - Intergenic
931518982 2:63074488-63074510 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
931647693 2:64440022-64440044 ACGTGTCAATAAAAGATAAAAGG - Intergenic
932074335 2:68649097-68649119 TAATTTCAATGAAAGCAAAAAGG - Intronic
932155904 2:69417133-69417155 TTGTCTGAATGAGAAAAAAAGGG + Intronic
932181486 2:69650478-69650500 CTGTCTCAAAGAAAAAAAAAAGG - Intronic
932320694 2:70820214-70820236 TAGTTTGAATGAAAGAAGAAAGG + Intronic
932799469 2:74727040-74727062 TTGTGTCAATAAAAATAATAAGG - Intergenic
933595000 2:84274396-84274418 TTGTGTCCATCAGAGGAAAATGG + Intergenic
933648828 2:84832793-84832815 CTGTCTCAATTAAAAAAAAAAGG + Intronic
933866685 2:86524946-86524968 TTGTGTAAATAAATGATAAATGG - Intronic
933910956 2:86941389-86941411 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
933988927 2:87619544-87619566 TTGTGTCAACTAAAAATAAAAGG + Intergenic
934053772 2:88234095-88234117 TTGTTTCAATTAAAAAACAATGG + Intergenic
934495697 2:94795388-94795410 CTGTCTCAATAAAAAAAAAAAGG + Intergenic
934942550 2:98513026-98513048 TTGTTTGAAAGAAAAAAAAATGG + Intronic
935807887 2:106766990-106767012 TTGTGGCAATGAAACAAATGGGG - Intergenic
936304916 2:111331282-111331304 TTGTGTCAACTAAAAATAAAAGG - Intergenic
936630505 2:114197713-114197735 TTTTGTCCATTAAAAAAAAATGG + Intergenic
936964153 2:118110684-118110706 TTTTTTCAATGAAAGAAAATGGG + Intronic
937002801 2:118483610-118483632 TTGTTTCAATGAAAAGAATATGG + Intergenic
937223479 2:120355249-120355271 TTGTGTAAATGAGAAAACAAAGG + Intergenic
937468423 2:122154953-122154975 TTGAGTGAATAAAAGAATAAAGG - Intergenic
937648170 2:124288891-124288913 TTGTGTGAATAAATGAAAATTGG + Intronic
937756617 2:125547048-125547070 CTGTTTCAAAGAAAGAAAGAAGG - Intergenic
938004286 2:127775152-127775174 TTATCTCAATTAAAGAATAATGG + Intronic
938285292 2:130109129-130109151 TAGTGTGAATCAAAGCAAAATGG - Intronic
938335942 2:130497670-130497692 TAGTGTGAATCAAAGCAAAATGG - Intronic
938353882 2:130622995-130623017 TAGTGTGAATCAAAGCAAAATGG + Intronic
938430307 2:131229764-131229786 TAGTGTGAATCAAAGCAAAATGG + Intronic
938475123 2:131602947-131602969 TAGTGTGAATCAAAGCAAAATGG + Intergenic
939149744 2:138458993-138459015 TTGGGTCAATGAAATGAAGATGG + Intergenic
939250523 2:139675930-139675952 TGGTGTCAATAAAACAAAAATGG + Intergenic
939440923 2:142248312-142248334 TTGTGGCAATGACAAAAAGATGG + Intergenic
939758471 2:146143871-146143893 TCCTGTGAAGGAAAGAAAAACGG + Intergenic
939853629 2:147330455-147330477 TTAAGACAATGAATGAAAAAAGG + Intergenic
940002826 2:148983887-148983909 GTGTTTGAATGAATGAAAAAAGG + Intronic
940139177 2:150474550-150474572 TTGAGTCACTGAAAGAAGGAAGG + Intronic
940149745 2:150586397-150586419 CTGTGCCAATAAAAGAAAAAAGG - Intergenic
940261402 2:151783617-151783639 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
940432600 2:153610866-153610888 TTGTTTCAATGAAAGAAAGAAGG + Intergenic
940534555 2:154924128-154924150 TAGGGGCAATGAAAGAAAACAGG - Intergenic
940676523 2:156730404-156730426 CTGAATGAATGAAAGAAAAAAGG - Intergenic
940800490 2:158127452-158127474 GTGAGTGAATGAAAAAAAAAAGG + Intronic
941432780 2:165431850-165431872 TTTTGTGAAAGAAAGAAAAAGGG - Intergenic
941577015 2:167245709-167245731 AAGTGTCAATGAAATACAAAAGG + Exonic
941673985 2:168324536-168324558 TTGTCTCAAAAAAAAAAAAAGGG + Intergenic
942368057 2:175250401-175250423 TTCTGTCAATGAATGAGAGAAGG - Intergenic
942674348 2:178411980-178412002 TTGTGTTAAAAAAAAAAAAAAGG + Intergenic
943271529 2:185811497-185811519 ATGTGGCAAAGAAAAAAAAAAGG + Intronic
943340982 2:186681974-186681996 TTGTGAAAATGCAAGAAAAGGGG + Intergenic
943643468 2:190383774-190383796 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
943831429 2:192467842-192467864 TTTTGTGAATGAGAAAAAAAGGG + Intergenic
944231364 2:197396767-197396789 TTGTGTGGAGGAAAGATAAAAGG - Intronic
944409025 2:199418844-199418866 TTGGGTCAAAGAGGGAAAAAAGG - Intronic
944754456 2:202745273-202745295 CTGTGTCAAAAAAAAAAAAAAGG + Intronic
945005805 2:205404668-205404690 TTTTTTAAAGGAAAGAAAAAAGG - Intronic
945012208 2:205477640-205477662 TTGTGTCTAGGAAAGTCAAAAGG + Intronic
945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG + Intergenic
945240652 2:207673456-207673478 TTGTGGAAAAGAATGAAAAATGG + Intergenic
945528443 2:210919856-210919878 TCATGTCAATGACAGATAAAAGG + Intergenic
945555344 2:211268729-211268751 TTTTGTCAACAGAAGAAAAAGGG + Intergenic
945564351 2:211378122-211378144 TTGTGTCAATGGGCAAAAAAGGG + Exonic
946386921 2:219388751-219388773 TTGTGACAATAAAAGCAATAAGG + Intronic
946595565 2:221302333-221302355 CTGTGTGCATGAAAAAAAAAAGG + Intergenic
946600322 2:221353092-221353114 TTGGGTCAAAGAAAGAGAAGAGG - Intergenic
946850399 2:223900777-223900799 TTGTGTGAAGGAAGGAAAAAAGG - Intronic
947283733 2:228486082-228486104 TTATGTTAATCATAGAAAAAAGG - Intergenic
947941626 2:234061343-234061365 TTGTATAAATGCAAGAAAACTGG + Intronic
948197225 2:236104893-236104915 CTGTCTCAAGGAAAAAAAAAAGG + Intronic
948754708 2:240152109-240152131 TTCTGTCCATGAAACAAAATGGG + Intergenic
1169009303 20:2237031-2237053 TTGAGTCATTGATAGGAAAATGG - Intergenic
1169157640 20:3346645-3346667 TTGTGCAAATGAAATAGAAAAGG + Intronic
1169365288 20:4987224-4987246 TTGAGTGGATGAAAGAATAAAGG + Intronic
1169474902 20:5922735-5922757 TTTTCTCAATGAAAGAAAGCAGG + Exonic
1169636330 20:7696145-7696167 TTTTTTCCATGAAAGAATAATGG - Intergenic
1169639584 20:7735564-7735586 ATGTGACAATGTGAGAAAAAAGG + Intergenic
1169783744 20:9336267-9336289 CCATGTGAATGAAAGAAAAAGGG - Intronic
1170269174 20:14504852-14504874 TTGTCTGTGTGAAAGAAAAATGG - Intronic
1170485389 20:16810504-16810526 TTGTTTTAAGGAAAAAAAAACGG + Intergenic
1170975817 20:21163348-21163370 TTTTGTCAAAGAAAGAAGGAAGG - Intronic
1171235355 20:23519966-23519988 TTGTGTTAATGAAAGATATGTGG - Intergenic
1172924164 20:38515225-38515247 GTGTGTGCATGTAAGAAAAATGG - Intronic
1172928001 20:38558240-38558262 TTATAACAATGAAAGAAAATAGG + Intronic
1174242039 20:49144651-49144673 TGGGTTCAATGAAAGCAAAAAGG + Intronic
1174248871 20:49203035-49203057 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1174896388 20:54453953-54453975 TTGTGTAAATGAAACCAAACAGG - Intergenic
1174903954 20:54530499-54530521 TTGTGTAAATGAAATCAAACAGG - Intronic
1175115800 20:56681009-56681031 TTATTTTAAAGAAAGAAAAAAGG - Intergenic
1177303967 21:19288603-19288625 TTGTGTCAAAGAAAGTGAACAGG + Intergenic
1177467902 21:21513429-21513451 TTAAGTCAATGAAATTAAAAAGG - Intronic
1178678997 21:34655936-34655958 TTGATTGAAAGAAAGAAAAAAGG - Intergenic
1178874920 21:36406587-36406609 ATCTGTCAATTAAAAAAAAAAGG - Intronic
1178956305 21:37025131-37025153 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1179228968 21:39483341-39483363 TTATCTCAGAGAAAGAAAAATGG - Intronic
1179241478 21:39596992-39597014 CTGTCTCAATTAAAAAAAAAAGG + Intronic
1180409484 22:12590833-12590855 TTTTGTCATACAAAGAAAAAAGG + Intergenic
1180574619 22:16760889-16760911 TTGTATCAATAAAAACAAAAAGG - Intergenic
1180721704 22:17914169-17914191 TTTTTTGAAGGAAAGAAAAATGG + Intronic
1181658870 22:24325655-24325677 CTGTGGCCATGAATGAAAAAAGG + Intronic
1182101010 22:27657321-27657343 TTGAATGAATGAAAGAACAAAGG - Intergenic
1182772569 22:32805779-32805801 ATGTGTCAATGAAAGTTGAAAGG - Intronic
1184460679 22:44636164-44636186 TTGTCTCAAAAAAAAAAAAAAGG + Intergenic
1184543136 22:45143159-45143181 TTGTCTCAAAAAAAAAAAAAAGG + Intergenic
1184575285 22:45359301-45359323 TGGTGAAAAAGAAAGAAAAAAGG + Intronic
1185203744 22:49524423-49524445 TTTTCACAATGAATGAAAAAGGG + Intronic
1185354739 22:50361219-50361241 CTGAGTCAATGAAGAAAAAAAGG - Intronic
949299406 3:2566470-2566492 GTATGTAAATGAAAGAATAAAGG - Intronic
949307419 3:2658288-2658310 TTGGGTGAAAGGAAGAAAAAAGG - Intronic
949676933 3:6466091-6466113 TTGTCTCCATGAATGACAAAAGG - Intergenic
949701441 3:6764025-6764047 TGATGTCATTGAAAGGAAAATGG - Intergenic
949743385 3:7262232-7262254 TTATGTCACTGAAAGAAATGGGG - Intronic
949794258 3:7829678-7829700 ATGTATCAATAGAAGAAAAAAGG + Intergenic
949835680 3:8267093-8267115 TTTTCTTAATTAAAGAAAAACGG - Intergenic
949838972 3:8299966-8299988 TTGTGAGAAAGAAACAAAAAAGG + Intergenic
950087977 3:10274380-10274402 TTGTGTTAAAGAAAGAAATTAGG + Intronic
950220238 3:11189943-11189965 CTGTTTCAAAAAAAGAAAAATGG + Intronic
950851402 3:16065273-16065295 TTGAGAGAATGAAAGAAGAAAGG + Intergenic
950876732 3:16282150-16282172 TTCTGTAAATGTAAGAAAAGGGG + Intronic
951154762 3:19337547-19337569 TTTCATCACTGAAAGAAAAAGGG + Intronic
951209484 3:19958932-19958954 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
951570771 3:24060434-24060456 TTCTCTCAATTAAAGAGAAATGG + Intergenic
951662521 3:25085594-25085616 TTGTGTTCAGGAAAGAATAAAGG - Intergenic
951681830 3:25302911-25302933 TTGTGTGTATGTAAGAGAAAGGG + Intronic
951689842 3:25383924-25383946 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
951834055 3:26961556-26961578 TTATGTTAAAAAAAGAAAAAAGG - Intergenic
951851237 3:27142541-27142563 TTGTGTGAAGGGAAGAAAAGAGG - Intronic
951989472 3:28660372-28660394 TTGTGCTCATGAAAGACAAAAGG - Intergenic
952359851 3:32619291-32619313 TTATGTCAATAATAGAACAAAGG + Intergenic
952413158 3:33067301-33067323 TTGTCTCAAAAAAAGAAATAAGG - Intronic
952446409 3:33385022-33385044 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
952464712 3:33570629-33570651 TTGGGACAATAAAATAAAAATGG + Intronic
952777630 3:37061407-37061429 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
953215676 3:40915473-40915495 TTGAGTGAATGAATGAACAAAGG + Intergenic
953438126 3:42896123-42896145 TTGTTTCTGTGAAAGAACAAAGG + Intronic
953500650 3:43430541-43430563 TTATGTCAATGGAAAAAAGAAGG - Intronic
953528500 3:43715755-43715777 ATGTTTCAAAAAAAGAAAAAAGG + Intronic
953856957 3:46506526-46506548 ATCAGCCAATGAAAGAAAAATGG + Intergenic
953877684 3:46675689-46675711 GTGAGTCAATGAGAGAGAAATGG + Intronic
953900362 3:46837417-46837439 TTGTGGAAATGAAAGATATAAGG - Intergenic
953946820 3:47156480-47156502 ATGTGTCAATAAAAGGAGAATGG + Intronic
954193469 3:48981325-48981347 TTGTTTCAAAAAAAAAAAAAAGG + Intronic
954319537 3:49822305-49822327 TTGTTTCAAAAAAAAAAAAAAGG - Intergenic
954645303 3:52127698-52127720 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
954958793 3:54546468-54546490 TTTTATCAATGGAAGAAGAAAGG - Intronic
955259376 3:57369970-57369992 TTGTGTCCATCATAGAAATAAGG + Intronic
955427199 3:58804280-58804302 TTGTTTCAATAAAAGGAGAAAGG - Intronic
955514032 3:59709024-59709046 TTATCTAAATGAAAGAAAAAGGG + Intergenic
955756701 3:62232076-62232098 TTGGTTCATTGAAAGTAAAAAGG - Intronic
956152160 3:66255004-66255026 CTGTGGCAATGAAAGAACCAGGG + Intronic
956183023 3:66534992-66535014 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
956619636 3:71208498-71208520 TTTTGATAAAGAAAGAAAAAGGG - Intronic
956798617 3:72737930-72737952 TTGTGTCACATTAAGAAAAAGGG - Intergenic
957555369 3:81759836-81759858 TTGTGTCATTTAAAAAAAAAAGG + Intronic
957567108 3:81898084-81898106 TTGTGTGAATGAAAGAAGGCAGG - Intergenic
957660207 3:83140431-83140453 CTGTGTTAATGGAAGATAAAGGG + Intergenic
958025521 3:88044124-88044146 TACTGTCAATGAAAGAAAGGAGG - Intergenic
958838531 3:99173890-99173912 TGGTGTCCCTGAAAGAAACAGGG + Intergenic
958895248 3:99822116-99822138 GTATGTCATTGAAATAAAAAGGG - Intronic
959065839 3:101656269-101656291 TTAAGTCAATAAAACAAAAAGGG + Intronic
959420321 3:106120350-106120372 TGGTGTGTATGAAAGAACAAGGG - Intergenic
959820657 3:110731108-110731130 TTGTGGTAATGCAAGAAAATTGG + Intergenic
959873584 3:111356312-111356334 TTCTATCAATGAAACAACAAAGG + Intronic
959933493 3:112006956-112006978 TTGTGACAATGTAGGAAATAGGG + Intronic
959939467 3:112065346-112065368 TTTTGTCAATTAAAAAAATAAGG - Intronic
960107763 3:113816598-113816620 TTGTCTGAATGTAAGAAACATGG + Intergenic
960222206 3:115126881-115126903 ATGAATGAATGAAAGAAAAAAGG + Intronic
960680285 3:120240587-120240609 TTCTGACAATGAAATTAAAATGG - Intronic
960892287 3:122461951-122461973 GTGTGGCAATGCCAGAAAAATGG + Intronic
961155840 3:124678802-124678824 CTGTGTCCATGCAAGTAAAATGG - Intronic
961905375 3:130257449-130257471 TTCTGTCTATCAAACAAAAAAGG + Intergenic
962096626 3:132299169-132299191 ATGTGTCAGAAAAAGAAAAATGG - Intergenic
962441965 3:135428496-135428518 TTATGTCAGTAAATGAAAAAAGG + Intergenic
962753495 3:138451491-138451513 TTGTGTCATTGAAACGAATAAGG + Intronic
962893310 3:139692096-139692118 TTGTGGAAATGAAAGAAAGGAGG - Intergenic
962986086 3:140537375-140537397 TTCTAGCAATGAAAAAAAAATGG + Intronic
963234166 3:142939452-142939474 TTGTGTAATTTATAGAAAAAAGG + Intergenic
963317988 3:143781320-143781342 TTGTTTCAATAAAAGTAAATTGG + Intronic
963651562 3:147987625-147987647 TTGTCTCAAAAAAACAAAAAAGG - Intergenic
963748168 3:149147035-149147057 TAGTGTTAATGAAAGGAGAAGGG + Intronic
963754651 3:149221869-149221891 TTGTGTCAATCAAGCAAATAAGG - Exonic
963882994 3:150548910-150548932 TTGTTCTAGTGAAAGAAAAATGG - Intronic
964410960 3:156397615-156397637 ATGTCTCTATGAAAAAAAAAGGG - Intronic
964418731 3:156478255-156478277 TTGTGTCACTTAAACAGAAATGG - Intronic
964797473 3:160515617-160515639 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
965375467 3:167918021-167918043 TTGTGACAAAGTAATAAAAATGG - Intergenic
965485635 3:169274971-169274993 TTGAGCCAAAGAAAGAATAAAGG - Intronic
965537584 3:169839704-169839726 CTCTGTCTATGAAACAAAAATGG - Exonic
965711547 3:171560562-171560584 TTATTTTAATGAATGAAAAAAGG + Intergenic
965901604 3:173647259-173647281 TTCTATCAATTACAGAAAAAAGG - Intronic
966022059 3:175225511-175225533 TTGTGTTAATGACAAGAAAAGGG + Intronic
966377904 3:179315766-179315788 TTGTATGAATGAAGGACAAAAGG - Intergenic
966969743 3:185032668-185032690 TTGTCTCAAGAAAAAAAAAAAGG - Intronic
967546708 3:190738490-190738512 TTGTCTCCAGGAAAGAGAAAAGG + Intergenic
968139071 3:196241671-196241693 TTCTGTCAATAAATGGAAAACGG - Intronic
968271731 3:197408281-197408303 TAGTTTAAATCAAAGAAAAATGG - Intergenic
969368364 4:6713926-6713948 TTGGGTAGATGAGAGAAAAATGG + Intergenic
969893619 4:10282408-10282430 TTGTGGCAATGAAAAGCAAAAGG - Intergenic
970160444 4:13183326-13183348 TTGTGTCAATCATAGTTAAAGGG - Intergenic
970273876 4:14376297-14376319 TTGTGCCAAGGAGAGAAAAAAGG - Intergenic
970399847 4:15706589-15706611 TTATGTCACAGAAACAAAAATGG - Intronic
970486156 4:16526680-16526702 TTGTGTCTTTGAAAATAAAAGGG + Intronic
970781047 4:19738302-19738324 TTGTTTCACTGATAGAAAACTGG + Intergenic
970980276 4:22087988-22088010 TCATTTCAATGAAAGAAATAAGG - Intergenic
971526329 4:27622999-27623021 TTGTATAAAAGAAAAAAAAATGG + Intergenic
972156063 4:36163568-36163590 TCTTGTCTATGAAAGAAAAAGGG + Intronic
972188416 4:36560703-36560725 TTGTCTCAAAAAAAAAAAAAAGG + Intergenic
972193868 4:36628870-36628892 TTATGTAAATGAAATAAAAAGGG - Intergenic
972429659 4:38968634-38968656 TTGTGTCAATGAAATATTACTGG - Intronic
973074946 4:45912421-45912443 TTGACTCAAAGAAAAAAAAAAGG + Intergenic
973181988 4:47280293-47280315 ATGTGTCAATAAAACAAAAGTGG - Intronic
973198191 4:47469644-47469666 TTGTGGCAATAAAATGAAAAGGG - Intergenic
973213721 4:47645444-47645466 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
973297467 4:48541310-48541332 GTGTGTCATTGACAGAAATAGGG - Intronic
975702617 4:77081027-77081049 CTGTGTCAAAAAAAAAAAAAAGG + Intergenic
975960129 4:79892729-79892751 TTGTGAGAATGAAAAATAAATGG - Intergenic
976040490 4:80879044-80879066 TTGGGTTAATAAAAGAAATAAGG + Intronic
976396489 4:84561173-84561195 ATGTAAGAATGAAAGAAAAAAGG + Intergenic
976425913 4:84903313-84903335 TTGCGTCAAACAAACAAAAAGGG + Intronic
976552965 4:86417410-86417432 TTGTGGCAATGAAAAAATATAGG - Intronic
977068369 4:92348598-92348620 AGGTGTAAATGAAAGAAATAGGG + Intronic
977364115 4:96045004-96045026 TTTTGTCAATGAAATATAAATGG - Intergenic
977405612 4:96594150-96594172 TTGAGTAAGTTAAAGAAAAAAGG + Intergenic
977612971 4:99055783-99055805 TGGTGTCACAGAAAGTAAAAAGG - Intronic
977757652 4:100692330-100692352 TTGTTCCAATGAAAGAAAAAAGG - Intronic
978374818 4:108063817-108063839 TATTTTTAATGAAAGAAAAAAGG + Intronic
978468908 4:109039864-109039886 TATGGTCAAGGAAAGAAAAAAGG - Intronic
979088795 4:116451382-116451404 TTGTTTCAAAAAAAAAAAAAAGG + Intergenic
979311303 4:119206943-119206965 TTGTGTCCAAAAAAGAATAATGG + Intronic
979503215 4:121463415-121463437 GTGTCTCAATGAAAATAAAAAGG + Intergenic
979665125 4:123302990-123303012 TTGAATAAATGAAAGAATAAGGG + Intronic
979676263 4:123413395-123413417 TTGTGTAAATGAAATATAGAAGG + Intergenic
980005212 4:127533778-127533800 TTATGAGAAGGAAAGAAAAAAGG - Intergenic
980327268 4:131363093-131363115 TTGAGTCACAGAAATAAAAAAGG + Intergenic
980421144 4:132563172-132563194 TTTTCTCAAACAAAGAAAAAGGG - Intergenic
980664484 4:135912176-135912198 TTTTTTCCATGAAAGGAAAATGG - Intergenic
980737321 4:136907458-136907480 ATGTGTCAATCAAAAATAAAAGG + Intergenic
981681188 4:147400209-147400231 ATTTGTCAATTAAAAAAAAAAGG - Intergenic
982171019 4:152661926-152661948 TTGTGTCAAAAAGAGAAAACAGG - Intronic
982184928 4:152786376-152786398 TTGTGTCATTCACTGAAAAAAGG - Intronic
982222380 4:153136032-153136054 TTGCATCAATGAAAGAATAGTGG + Intergenic
982305266 4:153923955-153923977 TTGTCTCAAAGGAAAAAAAAAGG - Intergenic
982424694 4:155244919-155244941 TTCTTTTAATGAGAGAAAAAGGG + Intergenic
982485705 4:155963058-155963080 TAGTGTCAATGAAAGAAAATGGG - Intergenic
982731221 4:158957431-158957453 GTGTCTCAAAAAAAGAAAAAAGG - Intronic
982929016 4:161378044-161378066 ATTTGACAATGAAAGCAAAAAGG + Intergenic
983054625 4:163086988-163087010 TTATCACAATGAAAGAATAAAGG - Intergenic
983085558 4:163440251-163440273 TTGTGTCAGTGTGAGAAATATGG + Intergenic
983183359 4:164674517-164674539 TAATGTCAAGAAAAGAAAAAGGG - Intergenic
983249814 4:165330938-165330960 TTGGTTCAAAGAAAGATAAATGG + Intronic
983472791 4:168176993-168177015 CTGTCTCAAAAAAAGAAAAATGG + Intronic
983951222 4:173644196-173644218 ATGTGTCAACTAAAGATAAAAGG - Intergenic
984726397 4:183025767-183025789 TTGTTTCAAAAAAACAAAAAGGG + Intergenic
984907348 4:184641068-184641090 TTGTACATATGAAAGAAAAAAGG - Intronic
985099542 4:186444773-186444795 ATGTATCCATGATAGAAAAAGGG - Intronic
985804595 5:2032942-2032964 TTCTGTGAAAGGAAGAAAAATGG - Intergenic
985985601 5:3513547-3513569 TCTTGTTAAAGAAAGAAAAATGG - Intergenic
986115838 5:4773506-4773528 TTGTGTTAATGAAGCATAAATGG - Intergenic
986596004 5:9422874-9422896 TGGAGTCAGTGAAAGAAAAGTGG - Intronic
987155609 5:15086911-15086933 ATGAGTCAATGAATAAAAAAGGG - Intergenic
987271667 5:16315372-16315394 TTGTCTGAATGAAATAAATATGG - Intergenic
987466102 5:18273793-18273815 TTGTGCCAGTAAAAGAAAATGGG + Intergenic
987638086 5:20572214-20572236 TTTTGTAAAAGAAAAAAAAAAGG + Intronic
988361552 5:30242225-30242247 ATGAGTTAAAGAAAGAAAAAAGG + Intergenic
988526369 5:31990818-31990840 ATGAGTCAATGAAATAAAACAGG + Intronic
989118398 5:37978894-37978916 TTGAGTCAATGAATGAAAGGAGG - Intergenic
989131925 5:38115325-38115347 TTGTGTTAGAGAAAGAGAAAAGG + Intergenic
989158625 5:38368852-38368874 CTCTGTCAAAGAAAAAAAAAAGG + Intronic
989191974 5:38679224-38679246 TGGTGCCAATGAAAATAAAATGG - Intergenic
989684698 5:44071727-44071749 TTGGGTGAATGAAAGAAGGAAGG + Intergenic
989747001 5:44840607-44840629 TTGCAGCAATGAAGGAAAAAGGG - Intergenic
989748353 5:44859731-44859753 TTGGGACAATGAAAGGAAGAGGG + Intergenic
989799363 5:45517790-45517812 TTGTGGCAAAGAAAGCTAAAAGG + Intronic
990279570 5:54235494-54235516 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
990457836 5:56005190-56005212 CTGTCTCAAAGAAAAAAAAAAGG - Intergenic
990459896 5:56021294-56021316 TTGTATCAAATAAAGAAAAATGG - Intergenic
990690261 5:58355789-58355811 TTGCTTCAATAAAAAAAAAAAGG - Intergenic
990826219 5:59901574-59901596 ATGAATCAATGAGAGAAAAATGG + Intronic
990974052 5:61541822-61541844 CTGAGTCAATGAAAAAAAAGGGG - Intronic
991158550 5:63467531-63467553 ATGTGTGGAGGAAAGAAAAAAGG - Intergenic
991239508 5:64441389-64441411 TTGAGTGAATGAAAGACAACAGG + Intergenic
992074285 5:73176599-73176621 TTGTCTCAAAGCAAGAAAATCGG - Intergenic
992176005 5:74149244-74149266 CTGTGTTGATGAAAAAAAAATGG - Intergenic
993094618 5:83467180-83467202 TTTTGTCAATAGAATAAAAATGG + Intergenic
993511176 5:88773206-88773228 TATTGTCGATGAAAGAATAATGG + Intronic
993592897 5:89817359-89817381 TTTTGTCAAAGAAAGAATTAAGG - Intergenic
993622410 5:90184453-90184475 TTGGGTGAAGGAAAGAAGAAAGG - Intergenic
994014504 5:94949231-94949253 TAGTGTCAGTGAAATAACAATGG + Intronic
994519291 5:100810666-100810688 TTATTTTCATGAAAGAAAAATGG + Exonic
994579457 5:101620834-101620856 CTGTTTCATTGAAAAAAAAAAGG + Intergenic
994757449 5:103812377-103812399 TAGTGTAAAAGAAAAAAAAATGG - Intergenic
994835084 5:104841215-104841237 CTGTGTAAATGAAAGAAATGGGG - Intergenic
995066183 5:107865586-107865608 TTGTGTAACTGTATGAAAAATGG + Intronic
995797317 5:115955794-115955816 CTGTGACAATGAGGGAAAAAGGG + Intergenic
995916739 5:117255877-117255899 TGCTGTCACTGACAGAAAAAAGG - Intergenic
996373589 5:122778889-122778911 TTGTGACTGTGAAACAAAAAAGG + Intronic
996976036 5:129435885-129435907 ATGTGACAATGAAAAAAATAAGG - Intergenic
997044256 5:130294688-130294710 CTGTCTTAATGAAAGAAAATAGG - Intergenic
997566275 5:134889227-134889249 CTGTGTCAAAAAAAGAAAAAGGG - Intronic
998084010 5:139301322-139301344 CTGTCTCAAATAAAGAAAAAAGG - Intronic
998120165 5:139569855-139569877 TTGTTTGAACAAAAGAAAAAAGG - Intronic
999546101 5:152630383-152630405 CAATGTCATTGAAAGAAAAAAGG - Intergenic
1000460788 5:161515244-161515266 TTGGGTAAATAAAAGTAAAAAGG + Intronic
1000576573 5:162982403-162982425 TTGTCTCACAGAAAGAACAAAGG + Intergenic
1000647191 5:163773112-163773134 TTATTTTAATGAAAGAGAAAAGG + Intergenic
1001439004 5:171723846-171723868 TTGTCTCTAAGGAAGAAAAAAGG - Intergenic
1002122119 5:177013074-177013096 TTGTATCAAAAAAAAAAAAAGGG + Intronic
1002858561 6:1059221-1059243 CTGTCTCAATAAAAAAAAAAGGG + Intergenic
1003461229 6:6330505-6330527 TTATGTCAGTGAAAGCAATAGGG + Intergenic
1003566109 6:7223555-7223577 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1003698748 6:8439079-8439101 CTGTGTCAAAGAAGGAAGAAAGG - Intergenic
1003748998 6:9034877-9034899 CTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1004330932 6:14720468-14720490 TTTGGTCACTGAAAAAAAAAGGG + Intergenic
1004405467 6:15329070-15329092 TTGTGTCAAGGAAACAAAGTAGG + Intronic
1005145041 6:22679880-22679902 TTTTGCCAATGAAAGAACCAGGG + Intergenic
1005149573 6:22733617-22733639 TCATGCCAATGAAAGAACAAAGG + Intergenic
1005443940 6:25901829-25901851 TTGTCTCAAAAAAAAAAAAAGGG - Intergenic
1005891499 6:30143884-30143906 CTGTGTAAATGAAAAAAAGAAGG - Intronic
1006207099 6:32356713-32356735 CTGTCTCAATGAAAAAAAAAAGG + Intronic
1006493305 6:34402764-34402786 CTGTCTCAAAGAAAAAAAAATGG + Intronic
1006549301 6:34807709-34807731 TCATGTCTATGAAAGAAATATGG + Intronic
1006555915 6:34866435-34866457 TAGTGTTTATGAAACAAAAATGG - Intronic
1006955488 6:37866740-37866762 CTGTGTCACTTAAAGAAAAGAGG + Intronic
1008047074 6:46862310-46862332 TTCTGTCAATGTAAAAAAATGGG - Intronic
1008101379 6:47394998-47395020 CTGTCTCAAATAAAGAAAAAAGG - Intergenic
1008744704 6:54655940-54655962 TTATTTCAATGTAAAAAAAAAGG + Intergenic
1008810973 6:55498368-55498390 TTGTGTAAATAATAGATAAAAGG + Intronic
1008955201 6:57208196-57208218 CTGTGTCAAAGAAAAAAACATGG - Intronic
1009277744 6:61705441-61705463 TTGTGGCAATTAAATAAGAAAGG - Intronic
1009357898 6:62774882-62774904 TTTTGTGAGTGACAGAAAAAAGG + Intergenic
1009507280 6:64500557-64500579 TTGTGTCAATTAAATACCAATGG + Intronic
1009576779 6:65473841-65473863 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1010337133 6:74699577-74699599 TTGGGTCACTAAAAGGAAAAAGG + Intergenic
1010462376 6:76128069-76128091 TTGTGACAATGAAAGAAAAAAGG - Intergenic
1010796701 6:80124847-80124869 TTGTTTCATTGAAAGAGAACAGG + Intronic
1010977674 6:82334548-82334570 ATGTGGAAATGAAAGGAAAAGGG - Intergenic
1010979940 6:82360514-82360536 TTGGGTCATTAGAAGAAAAATGG + Intergenic
1011656455 6:89556223-89556245 TTGTGTCAGTGTTAGAAGAAAGG - Intronic
1011710602 6:90048975-90048997 TTGTGTTAATGTAAGCAAAATGG + Intronic
1011729713 6:90248703-90248725 TGGGGTCAATGAAGGGAAAATGG + Intronic
1011802742 6:91036332-91036354 TTGTATAAATTACAGAAAAAGGG + Intergenic
1011864005 6:91798050-91798072 TTGTGTAAAAGAAAGCAAAATGG - Intergenic
1012146217 6:95686373-95686395 ATGTGTCATGGAAAGAGAAATGG + Intergenic
1012454372 6:99388505-99388527 CTGTGTCTATCAAAAAAAAAAGG - Intronic
1012548126 6:100443062-100443084 TCATGTCAATGAAAAAAAAAGGG - Intronic
1012961235 6:105624175-105624197 ATCTGTCTATGAAAGATAAAGGG - Intergenic
1013280619 6:108633481-108633503 TTTTGTCCTTGAAAGAAAAGTGG + Intronic
1013611761 6:111802435-111802457 CTGTCTCAAAGAAAAAAAAAAGG - Intronic
1013795460 6:113883133-113883155 TTATGTCAATTAAAAATAAAAGG + Intergenic
1013872976 6:114790052-114790074 ATGTATCAATTAAGGAAAAATGG - Intergenic
1014146617 6:118005342-118005364 TGGTTTCATTGAAAGAAACAGGG - Intronic
1014418202 6:121210027-121210049 TTGTGTATATTAAAGGAAAAGGG + Intronic
1014505728 6:122252809-122252831 TAGCATTAATGAAAGAAAAAAGG + Intergenic
1014654259 6:124079854-124079876 TTGTGTCACTGAGCGAACAAAGG + Intronic
1015002683 6:128238455-128238477 ATGTGACATTGAAATAAAAAGGG - Intronic
1015853769 6:137602416-137602438 ATGTATGAAAGAAAGAAAAATGG + Intergenic
1015871702 6:137782093-137782115 TTCTCTCAAAGAAAAAAAAAAGG - Intergenic
1015904407 6:138102349-138102371 ATGTGTCAATGAAAGAAAGCTGG + Intronic
1016495879 6:144661198-144661220 TTGAGTCATTAAAAGAATAATGG + Intronic
1016615051 6:146038153-146038175 TTGTTAAAATGAAAGAAGAAAGG + Intronic
1016861828 6:148728028-148728050 TTGTGTCTATGGCATAAAAAAGG - Intergenic
1017404061 6:154097524-154097546 TTTTGTGAATGAAATCAAAATGG + Intronic
1017619617 6:156282688-156282710 TTGGGCCAGGGAAAGAAAAAAGG + Intergenic
1018032736 6:159855388-159855410 TTGTGTCAACTAAAAATAAAAGG - Intergenic
1018442340 6:163824812-163824834 TTGTCTCAAAAAAAAAAAAAGGG - Intergenic
1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG + Intergenic
1018648810 6:165973477-165973499 TTTTGTGAGTGAAAGATAAAAGG + Intronic
1019010159 6:168838626-168838648 TTGTTTCAATGCAAGCAATAGGG + Intergenic
1019678417 7:2329830-2329852 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
1019902185 7:4029509-4029531 ATGAGTGAATGAAAGAAAATCGG - Intronic
1020143694 7:5626664-5626686 TTGTGTTAAAAAAAAAAAAAAGG + Intronic
1020503902 7:8959152-8959174 TTGTGAAAATGAAAGGAAATTGG + Intergenic
1020504005 7:8960471-8960493 TTGTGAAAATGAAAGGAAATTGG + Intergenic
1020607675 7:10358993-10359015 TGGTTACAATAAAAGAAAAAAGG - Intergenic
1020675613 7:11181551-11181573 ATGTGTCAGTGAAAGAAGAAGGG - Intergenic
1020982286 7:15085912-15085934 TTGTGTATATGACAGAAAGATGG - Intergenic
1021000931 7:15329284-15329306 TTAATTCACTGAAAGAAAAAGGG - Intronic
1021046978 7:15935207-15935229 TTCTGTTAATTAAAAAAAAATGG - Intergenic
1021271463 7:18592125-18592147 TTGTCTCAAATGAAGAAAAAAGG + Intronic
1021291585 7:18851822-18851844 TTCCGTAAAAGAAAGAAAAACGG - Intronic
1021350082 7:19581631-19581653 TTGTGTCAATGGAAGATGAGTGG + Intergenic
1021961475 7:25877416-25877438 TTAATTCAATGACAGAAAAAGGG - Intergenic
1022242523 7:28526849-28526871 TTCTGACAAAGAAAGAAAACAGG - Intronic
1023130173 7:36995166-36995188 TTGTGGGTTTGAAAGAAAAATGG - Intronic
1023423098 7:40005168-40005190 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1023754720 7:43405906-43405928 AATTGCCAATGAAAGAAAAAAGG - Intronic
1024123558 7:46269137-46269159 TTGTTTCAAAGAAAGTAAACTGG - Intergenic
1024585504 7:50838488-50838510 TTTTGTCAGTGAGAGAAAAATGG + Intergenic
1024774728 7:52770692-52770714 TGTTGTGAATGAAAGACAAAAGG - Intergenic
1025840230 7:65140341-65140363 TTGTGGCCATGCAAGAAAAGAGG + Intergenic
1025882832 7:65555624-65555646 TTGTGGCCATGCAAGAAAAGAGG - Intergenic
1025890612 7:65646980-65647002 TTGTGGCCATGCAAGAAAAGAGG + Intergenic
1025931384 7:65997424-65997446 CTGTCTCAAAGAAAAAAAAAGGG - Intergenic
1025993607 7:66514074-66514096 TGCTGTCAAAGAAAAAAAAAAGG - Intergenic
1025998678 7:66544505-66544527 ATGTCTCAAAGAAAGAAAAATGG + Intergenic
1026216206 7:68351634-68351656 CTCTGTCAAAGAAAGAAAGAAGG - Intergenic
1026231703 7:68489565-68489587 TAGTGTCAAAGAAAGAGGAAAGG + Intergenic
1026667301 7:72353785-72353807 TTGTGTAAATTAAAAAATAAGGG + Intronic
1026781613 7:73271681-73271703 TTCTGGTATTGAAAGAAAAAAGG + Intergenic
1026883302 7:73920957-73920979 TTTTGAAAATGAAGGAAAAAGGG + Intergenic
1026985128 7:74550188-74550210 TTGTCTCAAAAAAATAAAAAGGG + Intronic
1026991636 7:74589352-74589374 GTGTCTCAAAAAAAGAAAAATGG + Intronic
1027022467 7:74825119-74825141 TTCTGGTATTGAAAGAAAAAAGG + Intronic
1027065549 7:75120802-75120824 TTCTGGTATTGAAAGAAAAAAGG - Intronic
1027425196 7:78054983-78055005 TTGTGTGAATGAATGAAATAAGG - Intronic
1027571564 7:79874873-79874895 TTCTGTTGATCAAAGAAAAATGG - Intergenic
1028286223 7:89004946-89004968 TTGTGTGAATGAAACAGAAGAGG - Intronic
1028560610 7:92170951-92170973 TTGTGTCAATGAAGAAATTAAGG + Intronic
1028660519 7:93267461-93267483 ATTTGTAATTGAAAGAAAAATGG - Intronic
1028751186 7:94384724-94384746 TTGTCTCAAGAAAAGAAAAAAGG - Intergenic
1028802833 7:94986744-94986766 ATGTGTCAATTAAAAAGAAAAGG + Intronic
1028962574 7:96765912-96765934 TTGTATAAACAAAAGAAAAAAGG - Intergenic
1029022534 7:97380271-97380293 TTCTGTCTAGGAAAGGAAAATGG - Intergenic
1029133579 7:98352161-98352183 CTGTATCAATAAAAGAAAAATGG + Intronic
1029479182 7:100802586-100802608 TTGTATAAATAAAAGAAAATGGG - Exonic
1029553591 7:101252230-101252252 TTGAGTGAATGAAAGAGTAACGG + Intronic
1029621866 7:101695113-101695135 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
1030570947 7:111223549-111223571 TGGTGTGAATTAATGAAAAAGGG - Intronic
1030689680 7:112519542-112519564 ATTTGTCAACAAAAGAAAAACGG + Intergenic
1030929637 7:115506361-115506383 TTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1031049815 7:116933475-116933497 TTGTCTCAAAAAAAAAAAAAAGG + Intergenic
1031205478 7:118751753-118751775 TTGTTTTTAAGAAAGAAAAAGGG - Intergenic
1031240956 7:119238867-119238889 TTGTGTAAACAAAAGAAAACTGG + Intergenic
1031252841 7:119410801-119410823 TTGTATCACAGTAAGAAAAATGG + Intergenic
1031451507 7:121926296-121926318 TTCTGTCAAAAAAAAAAAAAAGG + Intronic
1031551605 7:123120767-123120789 TTGTGTCAATGTGACTAAAATGG - Intronic
1031566283 7:123301060-123301082 ATGAGTCAATGAAAGAAATTAGG + Intergenic
1031719237 7:125149625-125149647 TTGTGTATATGAGAGAAAAATGG + Intergenic
1031831088 7:126626581-126626603 TTGTGTCAAGGATGGACAAATGG - Intronic
1031851874 7:126875035-126875057 TTGTGGCCATGCAAGAAAAGAGG - Intronic
1032675693 7:134127873-134127895 ATGTGTTAATGAAAAAAGAAAGG - Intronic
1032684312 7:134215871-134215893 TTGTGTTGATGACAGATAAATGG + Intronic
1032771717 7:135065884-135065906 CTGTATCAAAGAAACAAAAATGG + Intronic
1033192958 7:139299401-139299423 TTTTGTGTATAAAAGAAAAAAGG - Exonic
1034231452 7:149531787-149531809 TTCTGTCAAAAAAAAAAAAAAGG + Intergenic
1034506002 7:151491730-151491752 CTGTGTCAAAAAAAAAAAAAGGG + Intronic
1034569865 7:151946730-151946752 TGGTGTCAAGGAAAGAACACTGG - Intergenic
1034824457 7:154248935-154248957 TTACTTCAAGGAAAGAAAAAGGG + Intronic
1035696494 8:1601640-1601662 TTGTCACATTGAAAGTAAAATGG + Intronic
1035828662 8:2671456-2671478 TTGTAAAAATGAAACAAAAAAGG + Intergenic
1035875009 8:3178742-3178764 TTATGTCCATGAAATAAAAATGG - Intronic
1035936203 8:3843212-3843234 TTGTGTTAATTACAAAAAAATGG - Intronic
1036057732 8:5277629-5277651 TAGAGGCAATGATAGAAAAATGG - Intergenic
1036119550 8:6000925-6000947 TTTTGTCCAGGAAGGAAAAATGG - Intergenic
1036514167 8:9428460-9428482 TTGTTTCTAGGAAAGAAAACTGG + Intergenic
1037021398 8:13976108-13976130 GTGTCTCAAAGAAAAAAAAAAGG + Intergenic
1037202057 8:16267153-16267175 TTGTGTTTATTAAAAAAAAAGGG + Intronic
1037453274 8:19038342-19038364 TCCTGTAAAAGAAAGAAAAAGGG - Intronic
1038457277 8:27684658-27684680 CTGTGTCAAAAAAAAAAAAAAGG + Intergenic
1038858678 8:31361533-31361555 TCGTGGCAATGAAAGAGAAGAGG + Intergenic
1038860411 8:31381610-31381632 TTGAGTCAATGAGAGACAACAGG - Intergenic
1039202723 8:35114352-35114374 GAGTGATAATGAAAGAAAAATGG - Intergenic
1039382813 8:37101637-37101659 TTGTGAGATGGAAAGAAAAAGGG - Intergenic
1039486946 8:37917510-37917532 TGGTATCAATGAAAGATATATGG - Intergenic
1039855622 8:41410003-41410025 ATGTATGAATGTAAGAAAAATGG - Intergenic
1040082621 8:43303533-43303555 TGGTGTGAATCAAAGCAAAATGG + Intergenic
1040112988 8:43580427-43580449 TAGTGTCCATGAATAAAAAATGG + Intergenic
1040847072 8:51854872-51854894 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1041304136 8:56442610-56442632 TTGTATCCAGCAAAGAAAAAAGG - Intronic
1041353626 8:56975981-56976003 TTCTGTCATTGAAGGAAAACAGG - Intronic
1041457089 8:58072886-58072908 TTGTGAAAAGGAAAGAGAAATGG + Intronic
1041573619 8:59367552-59367574 TTAGCTCAATGAAAGATAAAAGG - Intergenic
1041872649 8:62652510-62652532 TTATGTCTAATAAAGAAAAATGG - Intronic
1043007630 8:74839787-74839809 ATGTATCAATGGAAGAAAGAAGG - Intronic
1043210290 8:77505471-77505493 TTGTTTTAATGAAAGTGAAATGG + Intergenic
1043302521 8:78751621-78751643 TTGTGTCAACTAAAAATAAAAGG - Intronic
1043411072 8:79996180-79996202 TTGTGTAAATAATAGAAAATTGG - Intronic
1043651155 8:82594266-82594288 TTGTGGAAATGAAAGTAAAAAGG + Intergenic
1043663497 8:82777502-82777524 TTGTGTAAATGAAAAAATCATGG + Intergenic
1043957755 8:86382130-86382152 TTGTGTCTATGAAAAACAAAAGG - Intronic
1044335237 8:90975485-90975507 TTTTTTTAAAGAAAGAAAAACGG + Intronic
1044364245 8:91324723-91324745 TAGTGTTAATGAAGGAAACAAGG + Intronic
1044370808 8:91408555-91408577 TTGGGTCAAAAAAAGAGAAACGG - Intergenic
1044689757 8:94864992-94865014 TTGTTTCAACGAAAAAAATAAGG - Intronic
1045305848 8:100956057-100956079 TTTTTTAAATGAAAGAAAAGGGG + Intergenic
1045738766 8:105328787-105328809 TTATGTCAATGTAAGCAGAAAGG - Intronic
1046135559 8:110021696-110021718 TTGTATAGATGAAAGAGAAAGGG - Intergenic
1046198123 8:110889804-110889826 TTCTGTCAAAAAAAAAAAAAAGG - Intergenic
1046331680 8:112724271-112724293 GAGTGAGAATGAAAGAAAAATGG + Intronic
1046373300 8:113340862-113340884 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1046678978 8:117146266-117146288 TTGTTTTAAAAAAAGAAAAAAGG + Intronic
1046810633 8:118529345-118529367 TTGTGACAATGAAAGCCCAAAGG - Intronic
1047227644 8:122970333-122970355 ATTTGTCAATGAATGGAAAATGG - Intronic
1047383032 8:124381832-124381854 ATGTGTCAATGAAAGCATAACGG + Intergenic
1047465729 8:125111793-125111815 GTGTCTCAAAGAAAAAAAAATGG + Intronic
1048586380 8:135777884-135777906 CTGTCTCAAAGAAAAAAAAAGGG + Intergenic
1049338044 8:142096890-142096912 TTGGGTCAAGGAGACAAAAAGGG - Intergenic
1049994718 9:1024282-1024304 TTATGACAGTGAAAGAGAAAAGG + Intergenic
1050471201 9:5992714-5992736 TTGTGTTAAAAAAAAAAAAAGGG - Intronic
1050609513 9:7336991-7337013 TTATGTCAGTGAAACAAAGAAGG + Intergenic
1051021644 9:12551822-12551844 TTGGCGAAATGAAAGAAAAATGG + Intergenic
1051034155 9:12722965-12722987 TGGTTTCAATGCAAGTAAAATGG + Intergenic
1051234800 9:14988167-14988189 TGGTGAGAATGTAAGAAAAAGGG + Intergenic
1051335229 9:16059812-16059834 GTGTGTTAAAGAAAAAAAAAAGG - Intronic
1051461095 9:17316930-17316952 TTGTGACAATAAAAGCATAAAGG - Intronic
1051736917 9:20209749-20209771 ATGTGTCCATGAAAGAAAAGTGG + Intergenic
1051783516 9:20716696-20716718 GTGTGTGAATCAAAGAAATATGG - Intronic
1051960611 9:22758131-22758153 CTGAGTCAAAGAAAGGAAAAGGG - Intergenic
1052095440 9:24378642-24378664 TTCTGTCCATGAGAGAGAAAAGG + Intergenic
1052123639 9:24749706-24749728 TTTTTTAAATGAAATAAAAATGG + Intergenic
1052184899 9:25581071-25581093 TTGAGTGAATTAAAGTAAAATGG + Intergenic
1052273787 9:26655629-26655651 TTGTGTTCATAACAGAAAAATGG - Intergenic
1053325455 9:37143524-37143546 TTCTGTGTATGAAAGAAAATAGG + Intronic
1053911806 9:42914329-42914351 CTGTTTCAATGAAAAAAAAAGGG - Intergenic
1053942038 9:43260807-43260829 CTGTTTTTATGAAAGAAAAAAGG - Intergenic
1054373552 9:64431203-64431225 CTGTCTCAATTAAAAAAAAAGGG - Intergenic
1054909436 9:70440621-70440643 TTGTGTCAAAGAAAAAAAAAAGG + Intergenic
1055543810 9:77345335-77345357 ATGCTTCAAAGAAAGAAAAATGG + Intronic
1055704917 9:78987768-78987790 TTGGGGAAAGGAAAGAAAAATGG + Intergenic
1055727269 9:79244435-79244457 TTGTGTTAGTGAAAAAGAAAGGG + Intergenic
1055769690 9:79703932-79703954 GTAAGTCAATGAAAAAAAAAGGG - Intronic
1055991560 9:82111655-82111677 TGGTGGCAATCCAAGAAAAAGGG - Intergenic
1056026944 9:82508214-82508236 TATTGCCAAAGAAAGAAAAAAGG + Intergenic
1056139974 9:83666732-83666754 ATATGCCATTGAAAGAAAAATGG + Intronic
1056407798 9:86292462-86292484 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1056785120 9:89586754-89586776 TTCTGTCAATTAAAGGAAATTGG - Intergenic
1057357452 9:94343659-94343681 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
1057533080 9:95871987-95872009 TTGAGTCTATGAAGTAAAAATGG + Intergenic
1057650299 9:96913967-96913989 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1057773938 9:97990283-97990305 TTGTTTCAATGGCAGAAAAGTGG - Intronic
1057891447 9:98873050-98873072 TTGTATGGATCAAAGAAAAAGGG + Intergenic
1058125048 9:101182506-101182528 ATTTGTCAATTAAAGAAAAGTGG + Intronic
1058194234 9:101954093-101954115 CTGTCTCAAAGAAAGAAAAAAGG + Intergenic
1059092443 9:111374249-111374271 TTGTGAAAAAGAAAGAAAACTGG + Intronic
1059189703 9:112313035-112313057 CTGTTTCAAAGAAAAAAAAAAGG + Intronic
1059353198 9:113680302-113680324 TTGTGATATTGAAAGAGAAATGG + Intergenic
1059989004 9:119846980-119847002 TTGTGTTATTGAAAGAAGAGAGG + Intergenic
1060203163 9:121664085-121664107 TTGTCTCTATGTAATAAAAATGG - Intronic
1060456397 9:123802704-123802726 CTGTGTCAAAAAAAAAAAAAAGG - Intronic
1060760373 9:126242331-126242353 TTATATCATTGAAACAAAAATGG - Intergenic
1062296327 9:135829515-135829537 TTGTCTCAAAGAAGAAAAAAAGG + Intronic
1062334770 9:136060264-136060286 TTGTGTAAAAGAGGGAAAAACGG + Intronic
1062545159 9:137059207-137059229 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
1062605382 9:137345655-137345677 TTGTCTCAAAAAAAAAAAAAAGG + Intronic
1062710613 9:137973249-137973271 TTGTGTCACTGAGGGAAAAATGG + Intronic
1062714282 9:137998257-137998279 TTGTGTAATTGAAAAATAAAGGG + Intronic
1185853723 X:3512908-3512930 ATGTATCAATAATAGAAAAAAGG + Intergenic
1185943178 X:4343998-4344020 TTGTGTAGATGAAAGATAAATGG - Intergenic
1186382132 X:9071884-9071906 TTGTATGAATGAAAGAAACAAGG - Intronic
1186722357 X:12319087-12319109 ATGTGTCAATGAAGGGACAAGGG - Intronic
1186886994 X:13923749-13923771 TTGGTTGAAAGAAAGAAAAAAGG - Intronic
1186943433 X:14538382-14538404 TGTTGGCTATGAAAGAAAAATGG - Intronic
1187203880 X:17162613-17162635 TTATAACAATTAAAGAAAAATGG + Intergenic
1187760027 X:22572533-22572555 TACTGTAAGTGAAAGAAAAATGG + Intergenic
1188016881 X:25115898-25115920 CCGTATCAATAAAAGAAAAAAGG - Intergenic
1188027982 X:25231330-25231352 TTGTCTCAAAAAAAAAAAAAAGG - Intergenic
1188191653 X:27178817-27178839 TTGTCTCACTGACAGAGAAAAGG + Intergenic
1188728024 X:33608703-33608725 TTTTCTGAATGAAAGACAAATGG - Intergenic
1188856468 X:35202126-35202148 TGTTCTCAATAAAAGAAAAAAGG - Intergenic
1189096685 X:38148003-38148025 TTATGGAAATAAAAGAAAAAAGG - Intronic
1189283332 X:39834461-39834483 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1189426424 X:40905529-40905551 TTGTCTCAAAAAAAAAAAAATGG + Intergenic
1189537749 X:41954105-41954127 AGGTGTGAATGAAAAAAAAAAGG + Intergenic
1189927592 X:45972873-45972895 TTGTCTAAATGAAAGCAACAAGG + Intergenic
1190058722 X:47197352-47197374 GTGTGTCAATCAAAGAGGAAAGG - Intronic
1190802246 X:53801577-53801599 TTGGGTCAAAGAAATCAAAAAGG + Intergenic
1191170067 X:57436117-57436139 TTGTGTCAATGAAGAAATTAAGG + Intronic
1192072006 X:67950762-67950784 TTGTGTCATGGAAAAAAGAATGG - Intergenic
1192766804 X:74148007-74148029 TTGTGTCCCTGAAAGAGATACGG + Intergenic
1192768234 X:74164260-74164282 TTTTTTAAATGAAAGAAAATTGG - Intergenic
1193139576 X:78013034-78013056 GTGTGTCAAAGAAAGTAATAGGG - Exonic
1193326212 X:80181086-80181108 TTGTGTTAATGATACAAAACTGG + Intergenic
1193726042 X:85040870-85040892 TGGTGGAAATGAAAGACAAAAGG - Intronic
1193823370 X:86194104-86194126 TTGTGACAAAGAAAGAAACCAGG + Intronic
1194250110 X:91563844-91563866 TTTTGTCAATGAATAAAAGAAGG + Intergenic
1194438399 X:93898051-93898073 TTGTTTCAATGAAATACAAGTGG + Intergenic
1194571068 X:95555089-95555111 TTGTGTTAATGACACAAAATTGG - Intergenic
1194679750 X:96837644-96837666 TTGTATCATTGTAAGTAAAAGGG + Intronic
1195215414 X:102695668-102695690 TTGTGACAATAACAGAAAAGAGG + Intergenic
1195433174 X:104812284-104812306 TTCTGTCAATGACATAAAATGGG + Intronic
1195601108 X:106749898-106749920 TTGTTTCAAAAAAAAAAAAAAGG + Intronic
1196661173 X:118270464-118270486 TTGTGTCAATGAAATAAGTCAGG + Intergenic
1197163970 X:123355717-123355739 TTGTGCTAATGAAACAAAATTGG - Intronic
1197247462 X:124181073-124181095 TTGTCTCAAAAAAAAAAAAAAGG - Intronic
1197313087 X:124930258-124930280 TTGTGTCAATGTAAAAAGAATGG - Intronic
1197426427 X:126302520-126302542 TGGTTTGAGTGAAAGAAAAAAGG - Intergenic
1197670741 X:129274219-129274241 GTGTCTCAAAGAAAAAAAAATGG - Intergenic
1197913489 X:131511212-131511234 TTGTGTCCCTGAAAGAGACATGG - Intergenic
1198272499 X:135067724-135067746 TTGTGTTAATGACACAAAAGTGG + Intergenic
1198505404 X:137296215-137296237 TTGAATGAATGAAAGAACAAAGG + Intergenic
1198762888 X:140052031-140052053 TTGTTTTACTGAGAGAAAAATGG - Intergenic
1199838628 X:151620439-151620461 TTGTTTCAGTGAAAAAAAAATGG - Intronic
1199898641 X:152151329-152151351 TTGAGTCAATGTAGGAAATAGGG - Intergenic
1199929180 X:152501236-152501258 CTGTTTCAATGTAAGCAAAATGG - Intergenic
1200569072 Y:4805093-4805115 TTTTGTCAATGAATAAAAGAAGG + Intergenic
1200699157 Y:6387327-6387349 ATGTGTCAGAGAGAGAAAAATGG + Intergenic
1201034955 Y:9777372-9777394 ATGTGTCAGAGAGAGAAAAATGG - Intergenic
1201728091 Y:17175936-17175958 CTTGGTAAATGAAAGAAAAATGG - Intergenic
1201921447 Y:19237905-19237927 TTTTGTCAAAGAGTGAAAAATGG + Intergenic
1201992656 Y:20044084-20044106 TAGTATCAATGAAATAGAAAAGG + Intergenic
1202142019 Y:21734937-21734959 TTATCTCAATTAAAAAAAAATGG - Intergenic
1202144846 Y:21768865-21768887 TTATCTCAATTAAAAAAAAATGG + Intergenic