ID: 945157511

View in Genome Browser
Species Human (GRCh38)
Location 2:206855149-206855171
Sequence GAATGGGCACAGTTTCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945157505_945157511 12 Left 945157505 2:206855114-206855136 CCGCAGGCTGAGGGAGGGAAAAA No data
Right 945157511 2:206855149-206855171 GAATGGGCACAGTTTCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945157511 Original CRISPR GAATGGGCACAGTTTCAGTT TGG Intergenic
No off target data available for this crispr