ID: 945162532

View in Genome Browser
Species Human (GRCh38)
Location 2:206907824-206907846
Sequence GGATCCAGCAATCCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945162528_945162532 7 Left 945162528 2:206907794-206907816 CCTCAAGAAACTAAAAATAGAGC 0: 21
1: 369
2: 1175
3: 2247
4: 4003
Right 945162532 2:206907824-206907846 GGATCCAGCAATCCCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945162532 Original CRISPR GGATCCAGCAATCCCCCTGT GGG Intergenic
No off target data available for this crispr