ID: 945167800

View in Genome Browser
Species Human (GRCh38)
Location 2:206964721-206964743
Sequence GCTCCTTTTTCCCAGTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945167800 Original CRISPR GCTCCTTTTTCCCAGTTTCA GGG Intronic
900477911 1:2884554-2884576 GCTCCTGGTTCCCAGTCTCGGGG + Intergenic
900984682 1:6066478-6066500 TTTCTTTCTTCCCAGTTTCAGGG + Intronic
901132744 1:6972516-6972538 GCTGCTCTTTCCCAGCATCAGGG + Intronic
903448319 1:23436628-23436650 GCTCGTGTTTCCCATGTTCAAGG + Exonic
903922636 1:26811591-26811613 TGTCCTTATTCCAAGTTTCAGGG - Intergenic
906765945 1:48433889-48433911 GCTCCTGCTTCTCAGTTTCTAGG - Intronic
908235864 1:62146885-62146907 GCTTGATTTTTCCAGTTTCAAGG - Intronic
908258369 1:62320325-62320347 GCTCCTTTTTCCTAGGGTTAGGG - Intergenic
909645844 1:77915892-77915914 GCTCTTTTTCCCAAGATTCATGG - Intronic
909932317 1:81510705-81510727 GGTCCTTTTTGTCATTTTCAAGG + Intronic
910882870 1:91938332-91938354 TTTCCTTCTTCACAGTTTCATGG - Intergenic
914381121 1:147117387-147117409 TCTCCCTGTTCCCAGTGTCATGG - Intergenic
914758417 1:150579619-150579641 GCTCCTTTATCACGGTTTTAGGG + Intronic
916472653 1:165139102-165139124 TTTCCTTGTTCTCAGTTTCACGG - Intergenic
917476682 1:175374851-175374873 GCTCCTTTTGCCTTGTTTCCTGG + Intronic
918622834 1:186624748-186624770 GCTACTTTTTCCCAGATTCCAGG - Intergenic
918910918 1:190567972-190567994 GCTCCTTTTTCCTAGATAAAGGG + Intergenic
918946217 1:191069159-191069181 GCTCATTGTTCTCAGTGTCATGG - Intergenic
920521235 1:206628446-206628468 GCTCCTTTTCACCATCTTCAGGG - Intergenic
920715051 1:208332417-208332439 TCTGCTTTTTCCCAGTGTCATGG + Intergenic
921423167 1:214972338-214972360 GCACCTGTTTCCCAGCTTCTCGG + Intergenic
923785384 1:237062770-237062792 GATCCTTTCCCTCAGTTTCAGGG + Intronic
923900677 1:238322909-238322931 GCACCTTTTGCCTAGTTGCAGGG + Intergenic
924055731 1:240122407-240122429 GCTCCTTAATCCCAGTTACTTGG - Intronic
1065425162 10:25594862-25594884 GCTCATTTTTCCTCATTTCATGG - Intronic
1065938408 10:30542127-30542149 GCTCCTTTTTTCCAGTTCGATGG - Intergenic
1068040686 10:51820331-51820353 ACTTCTTTTTCTCAGTTTTAAGG + Intronic
1069629035 10:69886598-69886620 GCTCCTTTCTACCATGTTCAAGG - Intronic
1070487915 10:76948303-76948325 GCCCCTGTTTCTCAGTTTCAGGG + Intronic
1071065952 10:81636354-81636376 TCTACTTTTGCCCATTTTCAGGG - Intergenic
1071104042 10:82073604-82073626 TCTCTTTTTTGCCATTTTCATGG + Intronic
1071321745 10:84466854-84466876 ACTCCTTTGTTCCAGTTACAGGG + Intronic
1075152190 10:119944030-119944052 GTGCCCTTTTCCCAGCTTCAGGG + Exonic
1076174978 10:128361471-128361493 TCTCCTTTCTCTCAGTTCCAAGG + Intergenic
1076476550 10:130757717-130757739 CCTCCTTCTTCCCAGTTTCAGGG + Intergenic
1078338148 11:10480056-10480078 GCTTCTTTCTCCCAGTCTCCTGG + Intronic
1079170773 11:18093366-18093388 TTTCCTTCTTCACAGTTTCATGG - Intronic
1079420181 11:20278676-20278698 GCTCCTTTGTCTCAGCTTCAAGG - Intergenic
1079583811 11:22099818-22099840 GCTCCTTTTTCTCTCTTTCTAGG - Intergenic
1080692149 11:34567100-34567122 TCTCCTTTTTTTCAGATTCAGGG + Intergenic
1080919619 11:36695993-36696015 GCTCCTATCTCTCAGTTTCCTGG - Intergenic
1081353769 11:42088231-42088253 GCTTCCTGTTCCCATTTTCAGGG - Intergenic
1082786552 11:57320443-57320465 CCTCCTCTTTCCCAGTCTCTTGG + Exonic
1083299091 11:61730920-61730942 GCTACATTTTCCCAGCATCAAGG + Intronic
1083410743 11:62490664-62490686 GCTCCCTTTGCCCAGTGACACGG + Intronic
1087009507 11:93499959-93499981 GCTCCTTTCCCCCAGTATCTGGG - Intronic
1087723057 11:101688487-101688509 GCTCAATTCTTCCAGTTTCATGG + Intronic
1089219590 11:116859577-116859599 GCATCTTCTTCCCAGTTTCAAGG - Exonic
1090720525 11:129468072-129468094 GCTCCTTTTTCTCATGTTCATGG - Intergenic
1090722530 11:129489589-129489611 GCTGCTTTTTCCCAGAGTCCTGG + Intergenic
1091022787 11:132116048-132116070 TCTCCTTTCTCCCAGTTCCCTGG + Intronic
1093374416 12:18407523-18407545 GTTTCTTTTTGCTAGTTTCAGGG - Intronic
1094125077 12:27014649-27014671 GCTCCTGTTTCCGTGTTTAACGG + Intergenic
1096392490 12:51239851-51239873 GCACCCTTTTCCCAGTCTCACGG + Intronic
1097722576 12:63039350-63039372 TCTGCTTTTTGCCATTTTCATGG + Intergenic
1098360771 12:69652325-69652347 GCTCCTTTTTCCCTGAGTCCTGG - Intronic
1099099421 12:78419578-78419600 TGCCCTTTCTCCCAGTTTCAAGG - Intergenic
1099611315 12:84875434-84875456 GCTTCTTTTACGCAGTATCAAGG + Intronic
1100109508 12:91221931-91221953 GCTCCTGGGTCACAGTTTCATGG + Intergenic
1101585330 12:106080748-106080770 GATCCATTTTCCACGTTTCAAGG - Intronic
1102647935 12:114415681-114415703 GCACCTTTTTCCCAGTTCCCAGG - Intergenic
1103171266 12:118822115-118822137 TTTCCTTTTTCACAATTTCACGG + Intergenic
1103376527 12:120460607-120460629 GCTCCTTTGTCCCAGGCCCAGGG - Exonic
1106063964 13:26325796-26325818 CCTCCTTTTGGCCAGATTCAGGG + Intronic
1107139876 13:36987087-36987109 CCTCCTCTTTGCCAGTTTAATGG + Intronic
1110761519 13:79235866-79235888 GCTCTTTTTTCCAACTTACAAGG - Intergenic
1111747408 13:92287854-92287876 GCTCCTTTTTCTCTTCTTCAGGG + Intronic
1112557378 13:100481078-100481100 TGTCCTTTTTCACAATTTCATGG + Intronic
1114380413 14:22197898-22197920 GCACCTGTTACCCAGTTCCAAGG - Intergenic
1114567717 14:23644812-23644834 CTTCCCTTTGCCCAGTTTCATGG + Exonic
1115807508 14:37068158-37068180 GCTCCTTATTCCCGGTATGATGG - Intronic
1115989497 14:39137765-39137787 GCTTCATTTTCCCACTTTCCTGG - Intergenic
1116051469 14:39808603-39808625 GCCCCTGTCTCCCAGTTTCTGGG + Intergenic
1116797329 14:49406212-49406234 GCTCCTAATTCCCAATTTGATGG + Intergenic
1117814560 14:59583467-59583489 CCTCCCTTTTCCCACCTTCAAGG - Intergenic
1119251986 14:73164184-73164206 GCACCATTCTCCCAGTTTCTAGG - Intronic
1123140139 14:106068496-106068518 ACTCCTTTTCCCCAGATTCCTGG + Intergenic
1123188712 14:106546196-106546218 ACTCCTTTATCCCAGATTCCTGG + Intergenic
1124586038 15:31008255-31008277 CTTCCTTGTTCCCAGTTTTAGGG + Intronic
1125314058 15:38412111-38412133 TCCCCTTTTTCACAGCTTCAGGG + Intergenic
1125824698 15:42666454-42666476 CCTTCCTTCTCCCAGTTTCAAGG - Intronic
1128716503 15:69912411-69912433 GATCCTTTTACCCAAATTCAAGG - Intergenic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1130096420 15:80859539-80859561 GGCCCTTGTTTCCAGTTTCAAGG + Intronic
1131101038 15:89690492-89690514 CCTCCTTTTTCCCGGGTGCAGGG + Intronic
1131204576 15:90432051-90432073 GATACATTTTCCCATTTTCATGG + Intronic
1131855195 15:96585992-96586014 GCTTCTTTTTCCCTTTTCCAGGG - Intergenic
1133660840 16:7915907-7915929 GATTCATTTTCCTAGTTTCAGGG - Intergenic
1133903026 16:9995037-9995059 CTTCCTTTCTCCCAGTCTCAGGG - Intronic
1134421685 16:14097735-14097757 GCTCCTTTGCCCCTGTTTCCAGG + Intronic
1134862907 16:17576644-17576666 GAACATTTATCCCAGTTTCAAGG - Intergenic
1136869439 16:33792103-33792125 ACTCCTTTATCCCAGATTCCTGG - Intergenic
1138066026 16:53942211-53942233 TCTCCTTACTTCCAGTTTCAAGG - Intronic
1139158190 16:64470051-64470073 GTTCCTGTTTCCCATTTTCAGGG + Intergenic
1139180963 16:64747956-64747978 GCTCCTGTTTCTCAGTTCCATGG + Intergenic
1139342211 16:66274977-66274999 GGTCCTTTTGCTCAGTGTCATGG + Intergenic
1203102734 16_KI270728v1_random:1323965-1323987 ACTCCTTTATCCCAGATTCCTGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1143835506 17:9689069-9689091 GATGCTTTTTCACAGATTCACGG + Intronic
1144620877 17:16817867-16817889 GGACCTTTTTCCCAGTCCCAGGG + Intergenic
1148615058 17:48995843-48995865 CCTCCTTTTTCCCCGTTCCCTGG + Intergenic
1149485178 17:57036972-57036994 GCTCCTTTCTGCCATTTTCCAGG - Intergenic
1150301828 17:64053639-64053661 GCTCCTTTTGCTCATTTTCCAGG - Intronic
1152503869 17:80733901-80733923 GCTCATTTCTTCCATTTTCAAGG + Intronic
1154981904 18:21509343-21509365 GCTGCTTGTTCCCATTTTAAAGG + Intronic
1155620998 18:27779566-27779588 GCTCCTTATTTCAAGATTCATGG + Intergenic
1156919810 18:42507865-42507887 TTTCCTTCTTCACAGTTTCATGG + Intergenic
1156948142 18:42860299-42860321 TCTCCTTCTTCTCAGTTCCATGG - Intronic
1157744833 18:50126240-50126262 GGACCTGTTTCCCTGTTTCAGGG - Intronic
1157773317 18:50370288-50370310 TCTGCTTTTTCACAATTTCAAGG + Intergenic
1157795401 18:50569881-50569903 GCTGCTTTTACCCAGTTGGAGGG - Intronic
1159937110 18:74377872-74377894 GCTCCTTTTTCTAAGTATAATGG + Intergenic
1162105691 19:8368385-8368407 GCTCCTTGTCCCCAGCCTCATGG + Intronic
1163623285 19:18373399-18373421 ACTTCTGCTTCCCAGTTTCAAGG - Intergenic
1164412073 19:28014454-28014476 TGTCCTTTGCCCCAGTTTCAAGG - Intergenic
1164444871 19:28308293-28308315 GCTCCTCTTCCCCAGCTTCAGGG + Intergenic
1164868777 19:31626148-31626170 CCTCTTTATTCCCAGTTCCAGGG + Intergenic
1166135872 19:40776954-40776976 ACTCCTCTTCCCCAGGTTCAGGG + Exonic
1167660591 19:50793867-50793889 GCTCTTTTTTCCCATCCTCAGGG + Exonic
928632726 2:33210586-33210608 GCTTCTTTTCCCCTGTTTCCTGG + Intronic
930451978 2:51552909-51552931 GCTTCCTTTTGGCAGTTTCACGG + Intergenic
930669634 2:54134907-54134929 CTTCCTTCTTCACAGTTTCATGG + Intronic
931065216 2:58578509-58578531 ACTCCTTTTTTCCAGTTTCTCGG - Intergenic
935703531 2:105836233-105836255 GTTTCTTTTTTTCAGTTTCATGG + Intronic
936637779 2:114278697-114278719 GTTTCTTTTTCTCAGTTTCCTGG + Intergenic
937224027 2:120357915-120357937 ACTCCTTCTTCCCAGGTGCATGG - Intergenic
939277370 2:140015878-140015900 ACTCCTTTGTCACAGTTTCATGG + Intergenic
939655123 2:144815109-144815131 ACTCCTTTTTCACAACTTCAGGG - Intergenic
940120621 2:150260784-150260806 GCTTGTTTCTCCCAATTTCAGGG - Intergenic
942095481 2:172533509-172533531 TCTACTTATTCCCAGTTTCCAGG + Intergenic
942263969 2:174201834-174201856 GCTCCTTTTACCAACTATCAAGG + Intronic
942461865 2:176174215-176174237 GCACATTTTACCCACTTTCAAGG + Intergenic
945167800 2:206964721-206964743 GCTCCTTTTTCCCAGTTTCAGGG + Intronic
945306321 2:208262627-208262649 TCTCGTTTTTTACAGTTTCAGGG - Intronic
947434748 2:230063476-230063498 GGTCTTTTTTCACTGTTTCAGGG - Intronic
948324516 2:237102746-237102768 CCTCCTTTTTTCCACTTTGAAGG + Intergenic
948614212 2:239187969-239187991 GCTGCTTTTTCCCAGATGCATGG - Intronic
1170407637 20:16055586-16055608 GCTCTTTCTTCCCATTCTCATGG + Intergenic
1170517864 20:17150267-17150289 GCTCCTTTTTCCTAATTTGCTGG + Intergenic
1173640954 20:44601461-44601483 CCTCCCTTTTCCCAGGTTCTTGG + Intronic
1174845564 20:53940002-53940024 GCTGCTTTGGCCCAGTTTCCCGG + Intronic
1177265156 21:18773937-18773959 TTTCCTTCTTCACAGTTTCAGGG - Intergenic
1177508074 21:22043341-22043363 GCACCTTTTTCCCAGGTACTAGG - Intergenic
1177522941 21:22253680-22253702 GGTCATATTTTCCAGTTTCAGGG + Intergenic
1179548975 21:42131347-42131369 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179548985 21:42131383-42131405 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179548995 21:42131419-42131441 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549004 21:42131455-42131477 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549013 21:42131491-42131513 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549023 21:42131527-42131549 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549043 21:42131599-42131621 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1179549053 21:42131635-42131657 CCTCCTGTTCCCCAGCTTCATGG - Intronic
1184026635 22:41862548-41862570 CCTCCCTTTTCTGAGTTTCATGG + Intronic
949596972 3:5558379-5558401 ACTTCTTTTTCCCAGGCTCAAGG + Intergenic
950285503 3:11741636-11741658 TTTCCTTGTCCCCAGTTTCATGG + Intergenic
950681352 3:14587315-14587337 CCTCCTGTTGGCCAGTTTCATGG - Intergenic
950804149 3:15582982-15583004 GCTCTTTTTTTCCAGGTACATGG - Exonic
951444668 3:22764780-22764802 GCTCCTGCTTCTCAGTTCCATGG - Intergenic
953105136 3:39870244-39870266 TCTCCTTCTTCCCTCTTTCAGGG - Intronic
953381495 3:42476113-42476135 TCTCCTATTCCCCACTTTCAAGG - Intergenic
953389003 3:42523774-42523796 GCTCCAGTGTCCCAGCTTCAAGG + Intronic
953620937 3:44532189-44532211 GCTCCTTTCTCACACCTTCAGGG + Intergenic
955294423 3:57722166-57722188 ATTCCTTTTCCCCAGTTTCAAGG + Intergenic
957118797 3:76061987-76062009 GCTTCTCTTTCCCATTTTAAAGG + Intronic
957550267 3:81695150-81695172 GCTCCCTCTTCTCAATTTCACGG + Intronic
958838473 3:99173176-99173198 GCTCTTTTTTCCCAGTCAGAAGG - Intergenic
960603173 3:119478230-119478252 GTTCCTTTTCCCAAATTTCATGG - Intronic
960666305 3:120112273-120112295 TCTGCTGTTTCCCAGTTGCATGG - Intergenic
960920466 3:122741846-122741868 GCCCCTTTTTGCCAATTTCATGG - Intronic
962351314 3:134658323-134658345 GTTCCTTTTTCCTAGTTTAGTGG + Intronic
963339484 3:144017598-144017620 GCTCCTCCTTCCTAGTCTCATGG + Intronic
963699568 3:148607505-148607527 GCTCATTTTTCCCAGTCTTAAGG - Intergenic
969922171 4:10550699-10550721 TTTCCTTCTTCCCAATTTCACGG + Intronic
973567455 4:52202521-52202543 TCTCCTTTATGCCAGCTTCAGGG + Intergenic
973757258 4:54087569-54087591 GCTCCTGTGTCCCAGGTTTAAGG + Intronic
976366798 4:84241636-84241658 GCCCACTTTTCCCAGTTTTAAGG - Intergenic
978182844 4:105821984-105822006 GCTCCTTTTTCCCAGAAAAATGG - Intronic
978711622 4:111789465-111789487 GCTCCTTGCTCCTAGTTTCAAGG + Intergenic
978883740 4:113741303-113741325 TCTCCTTCTTCACAATTTCATGG - Intronic
978910426 4:114056672-114056694 GTTACTTTTTTCCAGTTTTATGG - Intergenic
979073774 4:116244327-116244349 GATCCTATTTCCCAGATTCAGGG + Intergenic
981897872 4:149825468-149825490 GCTGCCCATTCCCAGTTTCAGGG + Intergenic
982206934 4:153003861-153003883 GCTACTTTCTCCAAGTCTCAAGG + Intergenic
983071147 4:163269570-163269592 CCTCCCTTCACCCAGTTTCAGGG - Intergenic
984158592 4:176224168-176224190 GCTACTGTTTCCCAGTCTCAAGG - Intronic
985283983 4:188315635-188315657 GCTCCATTTTCCCAGTGTGAAGG - Intergenic
985304093 4:188520475-188520497 GTTCCTATTTCCCAGTTCCCTGG - Intergenic
985577646 5:681169-681191 CCTCCACTTTCCCAGTTTCTGGG + Intronic
985592572 5:773267-773289 CCTCCACTTTCCCAGTTTCTGGG + Intergenic
988530627 5:32024240-32024262 TTTCCTTCTTCACAGTTTCAAGG - Intronic
989280346 5:39634388-39634410 TCTCCTTCTTCACAATTTCATGG + Intergenic
989558471 5:42824431-42824453 GCTCCTTTATTCCAGCCTCAGGG + Intronic
989743812 5:44804072-44804094 GCACCTTTCACCCAGTTTCCAGG + Intergenic
991264655 5:64703030-64703052 GCTTCTTTTTCAAAGTTTCTTGG + Intronic
992015540 5:72572028-72572050 GCTCCATCTTCCCAGTCTCAGGG + Intergenic
994163220 5:96580222-96580244 GCTCTTATTACCCAGTTTCTGGG - Intronic
994285062 5:97955064-97955086 CTGCCTTTTACCCAGTTTCAAGG - Intergenic
994586763 5:101718684-101718706 GTTTCTATTTTCCAGTTTCAAGG - Intergenic
994866868 5:105284789-105284811 TTTCCTTTCTCCCAGTTTTATGG - Intergenic
995147370 5:108801663-108801685 TCTTCTTTTTCACAGTTGCATGG + Intronic
996620258 5:125492713-125492735 GATTTTTTTTCCCATTTTCAAGG - Intergenic
998792047 5:145776529-145776551 TTTCCTTCTTCACAGTTTCATGG - Intronic
999441718 5:151606368-151606390 CCTCCCTTCTCCCAGTCTCAGGG - Intergenic
1002113589 5:176938780-176938802 TCTCCTTTCTCCCATTGTCAGGG + Intronic
1003401036 6:5791054-5791076 TCTCTTTTTTCCCAGCTTTATGG + Intergenic
1003467405 6:6393981-6394003 GCACCTCTCTCCCAGTTTTAAGG + Intergenic
1003601279 6:7519773-7519795 GCTCCTTTTCCCCGGCTTCCTGG + Intergenic
1004509862 6:16276811-16276833 GATGCTTTTTCCCAGTTCCCAGG - Intronic
1005324886 6:24690367-24690389 GCCCCCTTTTCCCAGGTTCAAGG + Intronic
1006267253 6:32935744-32935766 GGTCCTTTATCCCAGCTCCAAGG + Intronic
1006636578 6:35465612-35465634 GCTTCTGTTGCACAGTTTCAGGG + Intronic
1007369142 6:41414800-41414822 GCTTTGTTTTCCCAGTTCCAAGG + Intergenic
1007783960 6:44270073-44270095 GATCCTTACTCCCAGTTTCGTGG - Intergenic
1009502090 6:64426629-64426651 CATCCTTTTTCACATTTTCAAGG - Intronic
1009543832 6:65000239-65000261 GGTCCTTTTTCCCCCTTGCAGGG - Intronic
1010504665 6:76642458-76642480 GCCCCTTTTGTCCATTTTCAAGG - Intergenic
1011215750 6:85004007-85004029 ACTCCCTTTTCCCACTTTCCAGG + Intergenic
1011345170 6:86361404-86361426 GCTGCTTGTTCTCAGTTTCCTGG - Intergenic
1012619914 6:101330741-101330763 GTTCCTATCTCCCAGTTTCTGGG - Intergenic
1014091863 6:117413213-117413235 GCTTCTGGTTACCAGTTTCAAGG + Intronic
1014639952 6:123897281-123897303 GCTACTTATTCCCACCTTCATGG + Intronic
1015697178 6:135993555-135993577 GCTCTTTTTACCTAGTTTAAGGG - Intronic
1017019718 6:150130496-150130518 GCTTCTTTGTCTCAGCTTCATGG + Intergenic
1017079760 6:150656351-150656373 GCTCCTAATTCCTAGTTCCAAGG - Intronic
1019146800 6:169980880-169980902 GCTCCTTTCCGCCAGTCTCATGG - Intergenic
1020068611 7:5210325-5210347 GCTCCTCGTTCCCAGACTCAGGG + Intronic
1021497334 7:21290540-21290562 CCTCCTTATACCCAGTTTCTGGG - Intergenic
1021960570 7:25868919-25868941 GCTCCCTTTTCCTAGTTTCAGGG + Intergenic
1022205002 7:28155223-28155245 TCTCCTTTTACTCAATTTCAGGG + Intronic
1022394453 7:29973472-29973494 GTTCCTTTTCTCCAGTTGCAGGG - Intronic
1023548355 7:41342797-41342819 GCTCCCTCTTCTCAATTTCATGG - Intergenic
1024412549 7:49062351-49062373 CTTCCTTTTACCCAGTTTCCTGG + Intergenic
1025938057 7:66052770-66052792 GCCTCTGTTTCCCAGGTTCAAGG - Intergenic
1026015075 7:66666169-66666191 GCTCCTTCATCCCAGCTTCCCGG - Intronic
1026185155 7:68077063-68077085 GCTCATTTTTCTCAAGTTCAGGG - Intergenic
1028857716 7:95610693-95610715 GCCACTTTTTCCAAGGTTCATGG - Intergenic
1029032122 7:97479506-97479528 GCCCCTTTTTTCAAGTTTCCAGG - Intergenic
1029460830 7:100693432-100693454 TCTCCTTCTTCCCAGTTGCTCGG - Intergenic
1029536795 7:101162119-101162141 GCTCCTTTTTCCCAAGATCCTGG - Intergenic
1030368187 7:108670250-108670272 TGTCCTTATTCCAAGTTTCAGGG - Intergenic
1033718812 7:144034628-144034650 GCTGCTTATTCCTAGTTTGATGG + Intergenic
1033902033 7:146155222-146155244 GCTACCTTTTCCCAGTTCGAAGG - Intronic
1035634182 8:1131172-1131194 GCTGCTTTTCCCAGGTTTCAGGG + Intergenic
1037080998 8:14786428-14786450 GGTCATTTTTCCAAGTTTCATGG - Intronic
1038280861 8:26163137-26163159 TTTCCTTCTTCCCAATTTCATGG - Intergenic
1040447882 8:47514425-47514447 GCTCCTTGTTACCTGTTTGAGGG + Intronic
1040551477 8:48440722-48440744 GCTGCTTTTCCCCAGCTGCAGGG + Intergenic
1041538864 8:58960091-58960113 GCTACTGTTTTCCAGTTTGATGG - Intronic
1041720995 8:60975094-60975116 CCTCCTTTTTCCCCATTCCAAGG - Intergenic
1043108869 8:76152126-76152148 GCTCCATTTTCCCAGTGTCCAGG - Intergenic
1045763843 8:105644164-105644186 GCTACTTTGTTCCAGTTGCATGG + Intronic
1047352688 8:124090880-124090902 GCTGCTTATTCCAAGTTTCAAGG - Intronic
1048515783 8:135109825-135109847 GCTCTTTTTTTCCATTTGCATGG + Intergenic
1049375138 8:142285809-142285831 ACTCCTTTTTCCCAGTTAAGTGG + Intronic
1050071201 9:1816336-1816358 GTTTCTTTTCTCCAGTTTCATGG - Intergenic
1050696431 9:8284353-8284375 GATCTTTTTTATCAGTTTCATGG + Intergenic
1052035169 9:23672345-23672367 GCTTCTTTTTCCAAGTTCCATGG + Intergenic
1052914233 9:33911942-33911964 GATCCTTTTTTCCTGTTTCTAGG + Exonic
1053009512 9:34625174-34625196 TCAGCTTTTTCCCAGATTCATGG - Intronic
1055207390 9:73749490-73749512 TCTTTTTTTTCCCATTTTCATGG + Intergenic
1055958388 9:81795739-81795761 ACTCCATTTTCCCAATTACATGG - Intergenic
1056006315 9:82275218-82275240 GCTGCTTCTTCCCAGGATCAAGG - Intergenic
1056283218 9:85062587-85062609 GCTCCTGCTTCTCAGTTCCACGG - Intergenic
1059429506 9:114241407-114241429 GCTCCTTTTCCCCAGCTTCCAGG - Intronic
1060006309 9:120003096-120003118 GCTCCTGTTTCTTAGTTTCCTGG + Intergenic
1060398049 9:123329909-123329931 CCTCCTTTTTCCCAGGAGCAAGG - Intergenic
1061165313 9:128918993-128919015 GGGCCTTTGTCCCAGCTTCATGG + Intergenic
1061514838 9:131082959-131082981 GCTCCTGTTCCCCAGCTTCCTGG + Intronic
1186363976 X:8872599-8872621 GCTCCCTTGTTCCATTTTCAAGG - Intergenic
1189398027 X:40641024-40641046 GCTTCTTTTCTTCAGTTTCATGG - Intronic
1191872149 X:65756411-65756433 CCTCCTCTTTCCCAGTTCCATGG - Intergenic
1192065279 X:67878697-67878719 GCTGCTTTTTGCCATTTGCAAGG - Intergenic
1192333163 X:70196104-70196126 GTTCATTTTTACCAGTTTTATGG - Intronic
1193401450 X:81049053-81049075 TCTTCTTTTTCCTAGTTTCTTGG + Intergenic
1194448558 X:94015198-94015220 GCAGCTTCTTCCCAGTGTCAGGG + Intergenic
1195079635 X:101358695-101358717 GCTTCTTTTTCGTTGTTTCAGGG - Exonic
1195438900 X:104878744-104878766 GCTTCTTGTTCCCTGTTTAAAGG + Intronic
1196306247 X:114106696-114106718 CATCCTATTTCCCAGTTTCCTGG + Intergenic
1196706249 X:118720146-118720168 ACTTCTTATTCCCAGTTTCCAGG - Intergenic
1197785364 X:130192310-130192332 GCTCTTGCTTCCTAGTTTCAAGG - Intergenic
1197950317 X:131888505-131888527 TTGCCTTTTTCCCAGTTTTAAGG - Intergenic
1198111092 X:133503221-133503243 GCCCTTCCTTCCCAGTTTCAGGG - Intergenic
1199201903 X:145100811-145100833 GCTCTTTTTTTCCAGTTACCTGG - Intergenic
1200041590 X:153374737-153374759 ATTCCTTCTTCACAGTTTCATGG + Intergenic
1200167450 X:154046678-154046700 GCTCTCTCTTCCCAGTTTCTTGG - Intronic
1202279530 Y:23166640-23166662 TCACCTTTTTCCCAATTTTATGG + Intronic
1202284902 Y:23230192-23230214 TCACCTTTTTCCCAATTTTATGG - Intronic
1202432662 Y:24802711-24802733 TCACCTTTTTCCCAATTTTATGG + Intronic
1202437305 Y:24855427-24855449 TCACCTTTTTCCCAATTTTATGG - Intronic