ID: 945175779

View in Genome Browser
Species Human (GRCh38)
Location 2:207041708-207041730
Sequence CAGCCTCAATGGGCTGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945175772_945175779 9 Left 945175772 2:207041676-207041698 CCCATAGGAGCTCTCCTGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184
945175771_945175779 10 Left 945175771 2:207041675-207041697 CCCCATAGGAGCTCTCCTGCGGC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184
945175769_945175779 11 Left 945175769 2:207041674-207041696 CCCCCATAGGAGCTCTCCTGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184
945175773_945175779 8 Left 945175773 2:207041677-207041699 CCATAGGAGCTCTCCTGCGGCTG 0: 1
1: 0
2: 0
3: 4
4: 116
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184
945175776_945175779 -5 Left 945175776 2:207041690-207041712 CCTGCGGCTGGGTTAAATCAGCC 0: 1
1: 0
2: 0
3: 7
4: 42
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945175779 Original CRISPR CAGCCTCAATGGGCTGAATG TGG Intergenic