ID: 945175779

View in Genome Browser
Species Human (GRCh38)
Location 2:207041708-207041730
Sequence CAGCCTCAATGGGCTGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945175772_945175779 9 Left 945175772 2:207041676-207041698 CCCATAGGAGCTCTCCTGCGGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184
945175776_945175779 -5 Left 945175776 2:207041690-207041712 CCTGCGGCTGGGTTAAATCAGCC 0: 1
1: 0
2: 0
3: 7
4: 42
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184
945175769_945175779 11 Left 945175769 2:207041674-207041696 CCCCCATAGGAGCTCTCCTGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184
945175771_945175779 10 Left 945175771 2:207041675-207041697 CCCCATAGGAGCTCTCCTGCGGC 0: 1
1: 0
2: 1
3: 5
4: 79
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184
945175773_945175779 8 Left 945175773 2:207041677-207041699 CCATAGGAGCTCTCCTGCGGCTG 0: 1
1: 0
2: 0
3: 4
4: 116
Right 945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG 0: 1
1: 0
2: 3
3: 11
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945175779 Original CRISPR CAGCCTCAATGGGCTGAATG TGG Intergenic
900703741 1:4063260-4063282 CCTCCTCCATGGGCTGAACGTGG - Intergenic
902509248 1:16956943-16956965 CAGCGCCTAGGGGCTGAATGAGG - Intronic
902790699 1:18765948-18765970 CAGCATCAATTGGCTGATGGTGG - Intergenic
904759400 1:32791103-32791125 CAGCCTCAATGGAGAGATTGAGG - Intronic
905509136 1:38504579-38504601 ATACCTAAATGGGCTGAATGTGG - Intergenic
905515810 1:38561151-38561173 CTGCCCCAATGAGATGAATGAGG - Intergenic
907012212 1:50974195-50974217 CAGGCTCTATGGGAGGAATGAGG + Exonic
907505213 1:54913259-54913281 CACCCTCACTGGGCTCCATGAGG - Intergenic
911737102 1:101349558-101349580 CAGCCTCAGGGGGCTGAAGCAGG + Intergenic
915310082 1:155002256-155002278 CAGCAGCAAAGGGCTGGATGGGG + Intergenic
918099540 1:181361582-181361604 CTGCCTCAATGGGGTGACTATGG - Intergenic
919600786 1:199619768-199619790 CAAATTCAATAGGCTGAATGTGG + Intergenic
920451010 1:206061219-206061241 GAGGCCCAATGGGCTGAGTGTGG + Intronic
920567532 1:206986945-206986967 GAGCCTCAAAGGGCTGATTAGGG - Intergenic
921307499 1:213811638-213811660 GAGCCTCAATGGGCAGAAAAGGG + Intergenic
924018788 1:239758118-239758140 CAGCCTCAATGGGCAGTTTTAGG - Intronic
1066308918 10:34176457-34176479 CAGCCTCAATTAGCTGATGGTGG + Intronic
1067463703 10:46477951-46477973 CAGCACCAATGGGCTGACTTTGG + Intergenic
1067623491 10:47906700-47906722 CAGCACCAATGGGCTGACTTTGG - Intergenic
1069722272 10:70557325-70557347 CAGGCTCTATGGGCTACATGCGG + Intronic
1071524294 10:86349227-86349249 CAGCCTCCATGGGTGAAATGGGG - Intronic
1072619269 10:97068806-97068828 TAGCCTAAATGGGCGGAATCTGG - Intronic
1074016860 10:109542916-109542938 CAGCCCCAATGAGATGAATCAGG + Intergenic
1075154390 10:119962288-119962310 CAGTCTCGATGGGCTAAATGAGG + Intergenic
1075345458 10:121678896-121678918 AAGCTTTTATGGGCTGAATGTGG + Intergenic
1076016643 10:127033079-127033101 CTGCCTCAAAGGGCTTAGTGAGG + Intronic
1076576489 10:131473377-131473399 CAGCCTCAGTGGGCTGAGCTGGG + Intergenic
1076804729 10:132849726-132849748 CAGCCTCCCTGGGCTGTAGGGGG + Intronic
1078713702 11:13819172-13819194 CAGCTTTTATAGGCTGAATGAGG + Intergenic
1080055164 11:27899318-27899340 AAGCAACAATAGGCTGAATGGGG + Intergenic
1080880238 11:36312947-36312969 CAGCTTCCAAGGGCTGAGTGTGG + Intronic
1083886655 11:65576451-65576473 CAGGCTCAAAGGGCCGGATGAGG - Intronic
1084412793 11:69013914-69013936 CCGCCTCCAGGGGCTCAATGGGG - Intergenic
1084500726 11:69533775-69533797 CAGCCGGAAGGGGCTGAGTGGGG - Intergenic
1084960657 11:72714524-72714546 CACCCTCTTTGGCCTGAATGAGG + Intronic
1085916261 11:80891751-80891773 CAGCCTCTACAGACTGAATGAGG + Intergenic
1088386155 11:109258697-109258719 AATCCCCAATGGGCTGGATGTGG - Intergenic
1089936266 11:122367180-122367202 TAGCCGTAATGGTCTGAATGTGG - Intergenic
1091582523 12:1798009-1798031 CAGGCTCAATGGGTGGAGTGTGG - Intronic
1092052723 12:5483955-5483977 CTGCCTCCATGGGCTGAGTAGGG + Intronic
1095083041 12:38029747-38029769 CACCCTCACTGGGCTCCATGAGG - Intergenic
1095979222 12:47961599-47961621 AAGACTCAGTGGGCTGATTGTGG + Intergenic
1096491137 12:52013700-52013722 CAGCGTCAATGGCCTGAATGTGG + Exonic
1096504311 12:52082927-52082949 CAGCAAGAATGGGCTGAAGGTGG - Intergenic
1099697560 12:86041022-86041044 CAGTCTCAATGAGATGAATCGGG + Intronic
1102966451 12:117131406-117131428 CATCCTCAGTGGGCTGAGAGGGG + Intergenic
1103291496 12:119849974-119849996 CAGCCTCATTGGGCTGAACGTGG - Intronic
1106102829 13:26709295-26709317 CACCCTCAGTGGGCTGACAGCGG - Intergenic
1108692483 13:52871728-52871750 CTGGCTAAATGGGCTGAGTGTGG - Intergenic
1108841903 13:54628107-54628129 CTGAATCATTGGGCTGAATGTGG - Intergenic
1113843715 13:113374379-113374401 CTGCCTCTCTGGACTGAATGTGG + Intergenic
1114455172 14:22849316-22849338 CAGCCTCACTGGGGTGGATCAGG - Intergenic
1114575142 14:23706285-23706307 CTGCCTCAATGAGATTAATGGGG - Intergenic
1115140647 14:30167571-30167593 CTGACTCAATGGGCTGAGTGAGG - Intronic
1116446819 14:45020967-45020989 CACCCTCACTGGGCTCCATGAGG - Intronic
1118763602 14:68895464-68895486 CAGCCTCATGGGACTGACTGGGG + Intronic
1120091581 14:80338465-80338487 CAGCAACAAGGGGCTGAAAGGGG - Intronic
1122165447 14:99819819-99819841 CAGCCTCACTGGGCTGGGGGAGG + Intronic
1122693239 14:103541316-103541338 GAGCCTCAATGGCCTGAGGGTGG - Intergenic
1123945260 15:25235844-25235866 CACCCTCCATGGGGAGAATGGGG - Intergenic
1132847678 16:2008014-2008036 CCGCCTTACTGGGCTGAAGGAGG - Intronic
1133389240 16:5395848-5395870 CAGCCTCTAGGGGCTGGAGGTGG + Intergenic
1134079174 16:11313155-11313177 TAGCCTCTATGGGCTGATGGGGG + Intronic
1135015697 16:18923352-18923374 AAGCCTAAATCGGCTGAGTGCGG + Intronic
1135923106 16:26668802-26668824 CAGCCTCCTTGGGCAGAATCAGG + Intergenic
1136294047 16:29291732-29291754 CAGCCTCACTGGGGTGTGTGTGG + Intergenic
1136332793 16:29592282-29592304 AAGCCTAAATCGGCTGAGTGCGG + Intergenic
1136447485 16:30332369-30332391 AAGCCTAAATCGGCTGAGTGCGG + Intergenic
1136455222 16:30376424-30376446 CCGCCTCAATGTGAAGAATGAGG + Exonic
1139168704 16:64603450-64603472 CCACCTCAATGGGGAGAATGGGG - Intergenic
1139233027 16:65305026-65305048 AAGCTTCAATGGGCTATATGTGG + Intergenic
1141284442 16:82658689-82658711 CAGCCACCATGTGCTGAGTGGGG - Intronic
1141553192 16:84819840-84819862 CAGGCTCAGCGGGCTGAAGGAGG - Intergenic
1141910844 16:87057493-87057515 CCGTCTCATTGGGCTGAATGGGG - Intergenic
1142099949 16:88265778-88265800 CAGCCTCACTGGGGTGTGTGTGG + Intergenic
1147258812 17:39197118-39197140 CAGCTTCAGTGGGCTGAGCGTGG - Intronic
1147952803 17:44116365-44116387 CAGCCCCTAGGGGCTGAATGAGG + Intronic
1148215491 17:45831878-45831900 CGGCTTCATTGGGCTGAAAGAGG + Intronic
1148864666 17:50622327-50622349 CAAACTCAGTGGGGTGAATGGGG + Intronic
1149570452 17:57668480-57668502 CAACCTCAGTGGTCTGAATCAGG + Intronic
1151149258 17:72069604-72069626 GACCCTCAATGGGCTGAATCTGG - Intergenic
1151430674 17:74060464-74060486 CAGCCTGCTTGGGCTGAAGGAGG - Intergenic
1151635927 17:75347763-75347785 TAGCCTGAGTGGGCTGAGTGTGG + Intronic
1153891815 18:9523891-9523913 CAGACGCAATGGAATGAATGAGG - Intronic
1153946672 18:10024030-10024052 CCCCCTCTATGGGCCGAATGTGG - Intergenic
1154343741 18:13525636-13525658 CAGCCTCACTGGGCTTGAGGAGG + Intronic
1156220826 18:35050419-35050441 AAACCTCAAAGGGCTAAATGAGG - Intronic
1166723399 19:45010608-45010630 CAGCCAGCATGGGTTGAATGGGG + Intronic
1167007372 19:46784758-46784780 CAGCCTCTTGGGGCTGAAGGAGG - Intronic
1167050537 19:47075270-47075292 CACGCTCAAAGGGCAGAATGCGG - Intronic
1167712556 19:51121412-51121434 CATCCTGAATGGGGTAAATGGGG - Intergenic
1167745680 19:51350379-51350401 CATCATCGATGGCCTGAATGGGG + Exonic
927999357 2:27509135-27509157 CACCCTCCATGGGCAGAATCAGG + Intronic
928087627 2:28355840-28355862 CATCCTCAGTGGGCTGGGTGAGG - Intergenic
928101824 2:28442578-28442600 CAGCCTCATTGTGCTTAATCAGG - Intergenic
932219372 2:69988008-69988030 CTGCCACAATGGGGAGAATGTGG + Intergenic
932720872 2:74138347-74138369 CAACACAAATGGGCTGAATGTGG + Intronic
933700893 2:85254802-85254824 CAGCCTCACTGGCCTAGATGAGG + Intronic
934715658 2:96541910-96541932 CTGCCTCTGTGGGCTGAGTGGGG + Intronic
934861285 2:97765316-97765338 CAGGCTCACTGGGCTGAATGAGG - Intronic
937225496 2:120366501-120366523 TAACCTCCAAGGGCTGAATGTGG + Intergenic
937742517 2:125373576-125373598 CCACTTCAATGGGCTCAATGTGG + Intergenic
943317518 2:186408737-186408759 CAGCCCCAATGGGCTGCCTGTGG + Intergenic
945175779 2:207041708-207041730 CAGCCTCAATGGGCTGAATGTGG + Intergenic
946249341 2:218403176-218403198 CAGGTTCATTGGGCTGCATGCGG - Intronic
948282834 2:236761330-236761352 CACGGTCAATGGGCAGAATGTGG + Intergenic
948739303 2:240032565-240032587 CAGCCTCAGGTGGCTGAATGGGG - Intergenic
1169376562 20:5071191-5071213 CAGCATCACTGGGCTATATGGGG + Intronic
1170390125 20:15863474-15863496 CAGCCTTAATAGGCTGGAAGAGG - Intronic
1170982956 20:21231928-21231950 CACCCTCTTTGGGCTGAATGTGG + Intronic
1174124716 20:48295627-48295649 CAGCATCAAAGTCCTGAATGAGG + Intergenic
1174977525 20:55351549-55351571 CACCCTCACTGGGCTCCATGAGG + Intergenic
1175001211 20:55632616-55632638 CAGGCTGAGTGGGCGGAATGAGG - Intergenic
1175830282 20:61961289-61961311 GAGCATCAGTGGGCTGTATGAGG - Intronic
1177875966 21:26632550-26632572 CAGCCTCAATGAGCTTAAGATGG + Intergenic
1178461302 21:32805185-32805207 CAGCCTCTAGGAGCTGAAAGAGG + Intronic
1178866185 21:36329360-36329382 CAGCCCCCATGGGATGCATGTGG - Intronic
1181995434 22:26877192-26877214 CATCTTCAATGGGTTGGATGAGG - Intergenic
1183326116 22:37195381-37195403 CAGCCCCAATTGGCTGACTTTGG - Intronic
1185366239 22:50438209-50438231 CATCATCAAAGGGCTGGATGCGG - Exonic
951838291 3:27005565-27005587 CACCCTCACTGGGCTCCATGTGG + Intergenic
952118821 3:30216380-30216402 AAGCCTCAGTGAGATGAATGTGG + Intergenic
952225465 3:31371242-31371264 CAACATCAAGGGGCTGAATCTGG + Intergenic
952883071 3:37997575-37997597 CAGCCTCCATGATCTGCATGAGG - Exonic
956327694 3:68071471-68071493 CATCATCAGTGGGGTGAATGGGG + Intronic
958629438 3:96668299-96668321 CACCCTCACTGGGCTCCATGAGG - Intergenic
959033566 3:101333251-101333273 AAAACTCAATGGGCTGAGTGTGG + Intronic
962042684 3:131723484-131723506 CAACCACAATGGGCTGAAGGAGG - Exonic
964990374 3:162803460-162803482 AAGCCTCCCTGGGCTGCATGTGG + Intergenic
966643444 3:182216147-182216169 CAGAGTCCATGGGGTGAATGTGG + Intergenic
968557404 4:1253358-1253380 CAACCTCAAGGGGCTGCATCTGG + Intergenic
968619563 4:1597642-1597664 CAGCCACATAGGGCTGGATGGGG - Intergenic
971153766 4:24061227-24061249 CAGCCTTAAGTGGGTGAATGTGG + Intergenic
972309283 4:37864810-37864832 AAGCCTGAAGGGGATGAATGGGG + Intergenic
972361467 4:38329395-38329417 CAGTCTGAAAGGTCTGAATGGGG - Intergenic
972616421 4:40702968-40702990 CAGCCAGAATATGCTGAATGGGG - Intergenic
975313422 4:72927578-72927600 CACCCTCACTGGGCTCCATGAGG - Intergenic
976702019 4:87980172-87980194 CAGCCCAAATGGCCTGAGTGTGG - Intronic
978727364 4:111984864-111984886 CAGACTCCATGGGGTGAAGGAGG + Intergenic
978814359 4:112886005-112886027 CAGTCTCACTGGGCTGGCTGAGG + Intronic
980872166 4:138623687-138623709 CACCCTCACTGGGCTCCATGAGG - Intergenic
982299649 4:153866046-153866068 CAGCCTCAGTGGAGAGAATGAGG + Intergenic
983366984 4:166804017-166804039 CAGCTTCTATGGGATGAAGGGGG + Intronic
985106728 4:186506924-186506946 CAGCCTCTAGGAGCTGAAAGTGG - Intronic
990617368 5:57521495-57521517 CACCCTCACTGGGCTCCATGAGG - Intergenic
995125783 5:108576039-108576061 CACCCTCACTGGGCTCCATGAGG - Intergenic
995398800 5:111717553-111717575 CAGTCCCAATGAGATGAATGGGG + Intronic
995490825 5:112690206-112690228 GAGCCAGAAGGGGCTGAATGGGG - Intergenic
997499162 5:134357921-134357943 AACCTTCAATGGGCTGGATGTGG + Intronic
998994258 5:147853192-147853214 CTCCTTCAATGGGCTGAAGGGGG + Intergenic
999920681 5:156316811-156316833 CATTGTCAAAGGGCTGAATGAGG + Intronic
1002522767 5:179800627-179800649 CAGCCTCCAGGGGCTGAGAGGGG + Intronic
1003305334 6:4922055-4922077 CAGCCTCATGGGCCTGAATTTGG + Intronic
1003689445 6:8338134-8338156 GAGCATCAGTGGCCTGAATGAGG - Intergenic
1005066587 6:21824151-21824173 CAGCCACAAAGGGCGCAATGTGG - Intergenic
1005349433 6:24919598-24919620 AAGCCTCAAGGGGCTGCTTGAGG + Intronic
1007318295 6:41007744-41007766 CAGCCTGAAGGGGCAGAATGAGG - Intergenic
1012982046 6:105841099-105841121 CATCCTCAACAGCCTGAATGAGG - Intergenic
1013022617 6:106234277-106234299 CACCCTCACTGGGCTCCATGAGG + Intronic
1013216437 6:108032055-108032077 CACCCACAAGGGGTTGAATGTGG - Intergenic
1014565825 6:122946648-122946670 CAGTCTCAATGGGGCGAATGAGG - Intergenic
1018518167 6:164611213-164611235 CAGCCCCAATTGGCTGACTTTGG + Intergenic
1019626501 7:2018593-2018615 CAGCCTGAAGGGGCTGTGTGAGG + Intronic
1021006535 7:15401493-15401515 CAACCTCAATAGTCAGAATGAGG - Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1021613005 7:22476028-22476050 CACCCCCAATGGGGTGAATTGGG + Intronic
1021782840 7:24122677-24122699 GAGCCTAAATGGGATGAACGGGG - Intergenic
1022131300 7:27406950-27406972 CAGCCTCTAGGAGCTGGATGAGG + Intergenic
1022872815 7:34497287-34497309 CTGCCACACTGGCCTGAATGTGG + Intergenic
1023603153 7:41900642-41900664 CAGACACAGTGGGCTGGATGAGG + Intergenic
1024036125 7:45509063-45509085 CAGCCTCAATGGCCCACATGGGG - Intergenic
1026019642 7:66697285-66697307 CAGCCTCCATGTGCTGTAGGGGG + Intronic
1027476602 7:78639769-78639791 CAGTCACACTGGCCTGAATGGGG - Intronic
1028587938 7:92469850-92469872 CACCCTCACTGGGCTCCATGAGG - Exonic
1032505061 7:132428279-132428301 CAGCCTGAGTGGGTAGAATGGGG - Intronic
1033499712 7:141935749-141935771 CAGCCTCAGTGGGTGGGATGGGG - Intronic
1035781135 8:2229160-2229182 CAGCCTCTGTGGGCTCAGTGGGG + Intergenic
1040556173 8:48479067-48479089 CAGCCTGCATGGGCACAATGTGG - Intergenic
1040855796 8:51946912-51946934 CAGCCTCTGTGTGCAGAATGGGG - Intergenic
1042939809 8:74096271-74096293 GAGCCTCATTGGTCTTAATGAGG - Intergenic
1045724587 8:105157823-105157845 TAGCTTTAAAGGGCTGAATGGGG - Intronic
1047925409 8:129678108-129678130 CAGCCAGAATGGGGTTAATGTGG + Intergenic
1049086916 8:140485946-140485968 AAGCCTTTATGGGCTGGATGTGG + Intergenic
1049246955 8:141567918-141567940 CTGACTCCCTGGGCTGAATGTGG + Intergenic
1050176635 9:2875702-2875724 CTGTCTCAGTGGGCTGAAAGTGG + Intergenic
1050391859 9:5152847-5152869 CAGTCCCAATGAGATGAATGTGG - Intronic
1052747510 9:32454807-32454829 CTGCCTCAGTTGGCTGAATAGGG + Intergenic
1062147828 9:134999881-134999903 CTGCCCCAATGGGATAAATGGGG + Intergenic
1062722149 9:138050183-138050205 CAGCCCCGATGGGGTGAAAGTGG - Intronic
1189504139 X:41594230-41594252 CTGCCTCTATAGGCAGAATGAGG - Intronic
1190334807 X:49255849-49255871 CTGGCTCAATGCTCTGAATGGGG + Intronic
1192171640 X:68859244-68859266 AAGCCCCTATGGGATGAATGGGG + Intergenic
1192221283 X:69198940-69198962 CTGCCTCAATGGGCTAGGTGAGG - Intergenic
1195414132 X:104602131-104602153 CAGTCCCAATGAGATGAATGGGG - Intronic
1197733665 X:129833750-129833772 CAGCCTCTAAGGGCTGTAAGTGG + Intronic
1198514196 X:137388023-137388045 GAGCCTTGATGGGCTGTATGAGG + Intergenic
1200269787 X:154671352-154671374 CAGTCCCAATGAGATGAATGAGG + Intergenic
1200965741 Y:9035809-9035831 CAGCTTCTATGGTCTGCATGGGG + Intergenic
1201345710 Y:12982515-12982537 CAGTCTCAAGGGTCTGAAGGAGG - Intergenic