ID: 945181612

View in Genome Browser
Species Human (GRCh38)
Location 2:207097466-207097488
Sequence ACTTTGTCACCTGTATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945181611_945181612 2 Left 945181611 2:207097441-207097463 CCAGAGAGAGATGTGGAAACAGA 0: 1
1: 0
2: 1
3: 41
4: 449
Right 945181612 2:207097466-207097488 ACTTTGTCACCTGTATGTCCAGG 0: 1
1: 0
2: 1
3: 9
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945181612 Original CRISPR ACTTTGTCACCTGTATGTCC AGG Intronic
900612735 1:3551203-3551225 ACTTTGTCACCTGCATGGGGCGG - Intronic
902604079 1:17559133-17559155 CATTTGTCAGCTGTGTGTCCTGG + Intronic
902747617 1:18483795-18483817 TCTTTCCCACCTGTGTGTCCCGG - Exonic
904019748 1:27454263-27454285 TCTTTGTAACCTGTAACTCCTGG + Intronic
906061757 1:42953546-42953568 GCTTTATCACCTTTATGCCCAGG + Intronic
906646296 1:47477959-47477981 AGGATTTCACCTGTATGTCCTGG + Intergenic
908049589 1:60214131-60214153 ACTTTGTCATCTGTTTTTCTAGG - Intergenic
908824645 1:68121641-68121663 ACTTTGTCTTCTGTATTTCAAGG - Intronic
909436629 1:75649544-75649566 TCTTTGTCAACTGTATTTCTAGG + Intergenic
910316414 1:85889576-85889598 CCTCTGTCACCTGTACTTCCAGG + Exonic
910330144 1:86063713-86063735 ACTTGTTCACCTGGAAGTCCTGG + Exonic
913189472 1:116401209-116401231 ACTTGGTCATCTGTAAGACCAGG + Exonic
915336065 1:155142580-155142602 AGTTTCTCAGCCGTATGTCCTGG + Intergenic
916449487 1:164906581-164906603 ACTTTGTCTTCTGGATATCCTGG + Intergenic
917290226 1:173464621-173464643 ACTTTGTCACCCCCATGACCTGG + Intergenic
922793341 1:228323009-228323031 ACTGTGTGGCCTGTAAGTCCAGG - Intronic
923934907 1:238749010-238749032 ACTTGGTGACCTGCATTTCCAGG - Intergenic
1062940124 10:1414765-1414787 ACTTTGTCACCCCCATGACCTGG + Intronic
1063976605 10:11422853-11422875 ACCTTCACACCTGTAGGTCCTGG + Intergenic
1064911961 10:20412012-20412034 CCTTTTTCATCTGAATGTCCTGG + Intergenic
1067405495 10:46019579-46019601 AGTTTGTCTCCCGTATGTTCCGG - Intronic
1067693511 10:48519592-48519614 ACTTTGTCACCTATGTGGCCTGG - Intronic
1069657526 10:70101052-70101074 ACTTTGTCACCCCCATGACCTGG - Intronic
1069666208 10:70161823-70161845 ACTTTGAAACCTGTATTTCAAGG + Intronic
1070630941 10:78084242-78084264 TCTAAGTCACCTGTAAGTCCTGG + Intergenic
1072504710 10:96053532-96053554 ACTCTTTCACATGTATGCCCTGG + Intronic
1072531897 10:96327486-96327508 ACCTTGTCAGCTGTGTGACCAGG + Exonic
1073729345 10:106271017-106271039 ACTTGGTGACCTGCATCTCCAGG - Intergenic
1075571941 10:123552541-123552563 TCTTGGTCACCTGTAGATCCTGG - Intergenic
1077082450 11:730151-730173 CCTTTGTCACATGGATATCCTGG - Intergenic
1078253368 11:9636879-9636901 GCTCTGTCACCTTTATGCCCAGG + Intergenic
1078260758 11:9705555-9705577 ACTTTGTGATCTGTATGCACTGG + Intronic
1079979927 11:27140175-27140197 AATTTGTCACCTGACTGTTCTGG + Intergenic
1081122690 11:39285944-39285966 ACTTGGTGCCCTGTATGTCAGGG - Intergenic
1084347985 11:68569372-68569394 ACTTTGTCACAGGTATGTATAGG - Intronic
1085658208 11:78336689-78336711 GCTGTGGCACCTGTATTTCCAGG - Intronic
1086344075 11:85877646-85877668 TCTTTGTCACTTGTATGTAGTGG + Intronic
1087935165 11:104025551-104025573 ACTTTCTCACATGTACTTCCTGG - Intronic
1089822399 11:121240449-121240471 ACTTTGTCACCCCCATGACCTGG + Intergenic
1089949055 11:122508510-122508532 TCTTAGTCACCTGTATGTCAAGG - Intergenic
1090236603 11:125152816-125152838 ACTCTGCCATCTGTGTGTCCAGG + Intergenic
1093348853 12:18071818-18071840 ACTTTGTCACCCCCATGACCTGG + Intergenic
1094250131 12:28350476-28350498 ACTTTGTCCAGTGTATGCCCGGG - Intronic
1094401410 12:30064281-30064303 ACTTTGTCACCCCCATGACCTGG + Intergenic
1097220556 12:57448139-57448161 CTTTTGTCACATGAATGTCCTGG - Intronic
1097999059 12:65921768-65921790 ACTTTTTCTCCTGGATCTCCAGG - Intronic
1103160373 12:118724320-118724342 ACTTTGCTGCCTGTATGGCCAGG - Intergenic
1105862999 13:24433411-24433433 ACTTTGTCACCCCCATGACCTGG + Intronic
1107312519 13:39094270-39094292 ACTTTGTCACCCCAATGACCTGG + Intergenic
1108215654 13:48181741-48181763 ACTTGGGCAACTGTATGTCAAGG - Intergenic
1110936019 13:81290491-81290513 ACTTTCTCACTTTTATGTACAGG + Intergenic
1111166676 13:84466592-84466614 ACTTTCACACATGTATGTACAGG + Intergenic
1113421462 13:110174490-110174512 CCTTTGTCACCTTTTTCTCCAGG + Exonic
1113818620 13:113194365-113194387 TTTTTGTCTCCTGTCTGTCCTGG - Intronic
1114519514 14:23324403-23324425 ACTTTGTCTCCTGCCTGTGCAGG + Intronic
1114599603 14:23943555-23943577 ATTTTGTTCCCTGTATGGCCAGG - Intergenic
1116054340 14:39844304-39844326 ACTTTGTCACCCCCATGACCTGG + Intergenic
1118050666 14:62023379-62023401 ATTTTATCACCTGTATGTTTGGG - Intronic
1121877726 14:97469263-97469285 ACTTTTTCACCTGTCTTTCCAGG + Intergenic
1123161387 14:106281487-106281509 TGTTTGTTACCTGTATTTCCAGG - Intergenic
1123172407 14:106386609-106386631 ACTTTGTTATCTGTATTCCCGGG + Intergenic
1124045566 15:26146967-26146989 TCTTTTTGACTTGTATGTCCTGG + Intergenic
1125116803 15:36103584-36103606 ACTTTGTCACCAGTTGCTCCAGG + Intergenic
1129084134 15:73070669-73070691 ACTTTGCCATATGTATGTACAGG - Intronic
1129823914 15:78621849-78621871 ACTTTGTCACCCCCATGGCCTGG - Intergenic
1130075201 15:80682857-80682879 ACATTGTGACTTGTATGGCCCGG - Intronic
1132556432 16:574773-574795 TCTTTGCCACCTGCCTGTCCCGG - Intronic
1133929170 16:10218236-10218258 ACTTTGTCTCCTGGAAATCCCGG + Intergenic
1134648083 16:15886971-15886993 TCATTGTCACCTCTATCTCCTGG + Intronic
1135086672 16:19480498-19480520 ACCTTTTCACCTTTATGTCCAGG - Intronic
1135252465 16:20912502-20912524 ACTTTGTCATCTGCCTGTCTTGG + Intronic
1136695246 16:32074314-32074336 TGTTTGTTACCTGTATTTCCAGG - Intergenic
1136795745 16:33017571-33017593 TGTTTGTTACCTGTATTTCCAGG - Intergenic
1136874172 16:33836809-33836831 TGTTTGTTACCTGTATTTCCAGG + Intergenic
1139546325 16:67651502-67651524 ACCCTCTCACCTGGATGTCCTGG - Exonic
1141284334 16:82657183-82657205 ACTTTATCACAGGTATGTACAGG - Intronic
1141677599 16:85525700-85525722 ACTTTGCCATCAGTATGTCTGGG + Intergenic
1203098004 16_KI270728v1_random:1279230-1279252 TGTTTGTTACCTGTATTTCCAGG - Intergenic
1143308889 17:5971950-5971972 ACCATGGCACCTGTTTGTCCAGG + Intronic
1143377820 17:6477861-6477883 TCTTTGTGACCTGGATGTCATGG + Intronic
1143829767 17:9641824-9641846 ACTTTGTCACAGGTTAGTCCTGG + Exonic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1154371477 18:13766479-13766501 TCTTTCTCACCTGTGTGTGCTGG - Intergenic
1158630538 18:59110313-59110335 AATATGTCACCTCTGTGTCCAGG - Intergenic
1158940133 18:62400057-62400079 ACCTTGTCACCTGCTTCTCCAGG + Intergenic
1167245324 19:48369615-48369637 ACTGTGCCAGCTGTATGGCCTGG - Intronic
929369925 2:41210509-41210531 ACTTTGTCACCCCCATGACCTGG + Intergenic
931248719 2:60512029-60512051 ACTGTGACACTTGTATTTCCTGG - Intronic
931899050 2:66767639-66767661 ACTTTATCAGCTGTACCTCCAGG + Intergenic
933613896 2:84464086-84464108 ACTTTGTCTTCTGTCTGTGCTGG + Intergenic
934736169 2:96691019-96691041 ACTGTGTCACCTGAGTGGCCTGG - Intergenic
938307743 2:130266444-130266466 ACCTTGACACCTGGAGGTCCTGG - Intergenic
938447595 2:131390397-131390419 ACCTTGACACCTGGAGGTCCTGG + Intergenic
944840778 2:203621736-203621758 ACTTTGTCATCCAAATGTCCTGG - Intergenic
945181612 2:207097466-207097488 ACTTTGTCACCTGTATGTCCAGG + Intronic
945598965 2:211834293-211834315 ACTTTGCCACCTGCCTTTCCAGG - Intronic
947140032 2:227012207-227012229 CCTGTGTCACCTTTACGTCCGGG + Exonic
947144326 2:227050975-227050997 ACCTGGTCACCTGGAAGTCCTGG + Exonic
947426543 2:229988455-229988477 ACCTTTTCACCAGTATATCCAGG + Intronic
1169978015 20:11352717-11352739 AGTTCTTCACCTATATGTCCTGG + Intergenic
1170368937 20:15627421-15627443 ACTTGGTCTCCTGTATGGCATGG - Intronic
1174011911 20:47456449-47456471 ACTTAGCCACCTGGCTGTCCCGG - Intergenic
1174769214 20:53282636-53282658 ACTCTGTCACCTGTCAGTCATGG - Intronic
1174774043 20:53327197-53327219 AACTTGTGACCTGTATGTTCTGG - Intronic
1177149712 21:17443245-17443267 AGTTTGTGACCAGTCTGTCCAGG + Intronic
1178928053 21:36792285-36792307 ACTTTGGCATCTGTGTGACCAGG + Intronic
1179469216 21:41599383-41599405 ATTTTGTCACCTGTAAACCCAGG + Intergenic
1180021071 21:45127368-45127390 ACTCTGTGACCTGTAATTCCAGG + Intronic
1180133254 21:45841970-45841992 CCTTTGTCACCAGTATGTGCTGG + Intronic
951685178 3:25335808-25335830 ATTTTGTCACCTATGTGGCCAGG + Intronic
951847539 3:27100937-27100959 ATTTTATCACCTGTCTTTCCAGG - Intergenic
956324079 3:68031373-68031395 TCTTTGGCACCTGTAAGTGCTGG - Intronic
956656031 3:71551496-71551518 TCTTTGTAATCTGTCTGTCCAGG - Intronic
961148418 3:124615014-124615036 AATTTGTCACATATATGACCAGG + Intronic
961712144 3:128835936-128835958 ACTTGGTCAGCTGTAGGTCTTGG - Intergenic
962386002 3:134933274-134933296 CCTTTTTCATCTGTATGCCCTGG + Intronic
962618490 3:137152284-137152306 ACTTTGTCACCAGTTGCTCCAGG + Intergenic
970184572 4:13436629-13436651 ACTTTGTCACATGTATTCCCAGG - Intronic
970325954 4:14925757-14925779 ACTTTGTCTCCAGTATGTTATGG - Intergenic
971107855 4:23546483-23546505 CCTTTGTCATATGTATGTCATGG + Intergenic
971991572 4:33904000-33904022 ACTTTTTCAACTGTATGTTTTGG - Intergenic
972987177 4:44778734-44778756 CCATTTTCACCTGTATTTCCAGG - Intergenic
974734444 4:65911672-65911694 ACTTTCTCCCAAGTATGTCCAGG - Intergenic
975475756 4:74821589-74821611 ACTTTCTCAACTATATCTCCAGG + Intergenic
975784350 4:77871939-77871961 ACTTTTACAACTATATGTCCTGG - Intronic
977039550 4:91999618-91999640 AATTTGTCTCCTGTATCTCTGGG + Intergenic
978218678 4:106241961-106241983 TCTTTGTGAGCTGTATGTCATGG - Intronic
980634791 4:135487450-135487472 ATTTTATCACCTTTTTGTCCTGG - Intergenic
984756653 4:183331190-183331212 ACTTTGTTAACTGTATAACCAGG - Intergenic
984837689 4:184037257-184037279 ACTTTTTCACCTGGATGGCTGGG + Intergenic
986956112 5:13151897-13151919 GCCTTGTTACCTGTATTTCCAGG + Intergenic
987115113 5:14720337-14720359 ACTTTATTACCTGAATGCCCTGG + Intronic
987956377 5:24747432-24747454 ACTTTGTCACCCCCATGACCTGG - Intergenic
988605040 5:32672029-32672051 ACTTTGTCACCCCTATGTCCTGG - Intergenic
995042807 5:107608545-107608567 CCTTTGTCCCCTGCATGTCATGG + Intronic
998133521 5:139662934-139662956 ATTATGTCACCTGGATCTCCAGG + Intronic
1000270309 5:159677705-159677727 ACTTTGTCACCTGCTTGTGATGG + Intergenic
1000410087 5:160928973-160928995 ACACAGTCACCTGTATGCCCTGG + Intergenic
1002378698 5:178808663-178808685 ACTCTGGCTTCTGTATGTCCAGG + Intergenic
1004999054 6:21222651-21222673 CCTTAATCCCCTGTATGTCCTGG + Intronic
1006973614 6:38074737-38074759 ACTTTTCCTCCTGTAAGTCCTGG - Intronic
1008465794 6:51829296-51829318 ACTGTGTCCACTGTGTGTCCTGG - Intronic
1009608364 6:65904055-65904077 ACTTTCTCATCTTTATGTGCTGG - Intergenic
1011294678 6:85813277-85813299 AATTTGTTAACTGTGTGTCCTGG + Intergenic
1012856755 6:104511323-104511345 AATTTGTCACCTGTATTTTTAGG + Intergenic
1013284993 6:108673471-108673493 TCTGTGTCACCTGTGTGTCCTGG + Intronic
1016109148 6:140200326-140200348 TCTCTGTCACCTGTATCTCAGGG - Intergenic
1017751560 6:157493790-157493812 ATTGTGTCACCTGTGTGTGCCGG - Intronic
1019684804 7:2375493-2375515 ACGTCGTCACCTCTGTGTCCTGG + Exonic
1022454432 7:30546140-30546162 ACTTTGTCACCCCCATGACCTGG + Intronic
1022676611 7:32506091-32506113 ACTTTATCATATGTATGTACAGG - Intronic
1026539437 7:71267611-71267633 GCTTTGTCTCCTGTGTGTACTGG + Intronic
1032743586 7:134764041-134764063 ACTTTGTTACATGTATCTTCTGG - Intronic
1033519324 7:142145133-142145155 ACTTTGTCACATGCTTGCCCTGG - Intronic
1034765247 7:153714594-153714616 ATTTTGTTACCTGAATGTCAGGG + Intergenic
1039789627 8:40864615-40864637 ACTGTGGCACCTTTATGACCTGG - Intronic
1041882350 8:62766603-62766625 CCTTTCTCACTTGTGTGTCCTGG - Intronic
1042393603 8:68264874-68264896 ACTTTGTCACCAATCTTTCCAGG + Intergenic
1042672503 8:71280313-71280335 ACCTTTTCACCTGAATTTCCTGG - Intronic
1044199716 8:89419764-89419786 ACTTTGTCATCAGTATGTTCTGG + Intergenic
1047391746 8:124457770-124457792 ATTTTGTCACATGTATGCCCAGG - Intronic
1050799665 9:9594190-9594212 ACTCTCTCACATGTGTGTCCTGG - Intronic
1052529296 9:29659766-29659788 ACTTTGTCACCCCCATGACCTGG - Intergenic
1054750432 9:68899321-68899343 ACTTTTTCACATGTAAATCCTGG + Intronic
1055804948 9:80082283-80082305 ACTTTGTTTCCTGTTTGGCCTGG + Intergenic
1056723696 9:89093615-89093637 ACTTTTTCACATCTATGTGCTGG - Intronic
1057296858 9:93851347-93851369 AGTTTGTCTCCTTTATTTCCTGG + Intergenic
1058146755 9:101420906-101420928 ACCTTGTCATCTGCACGTCCAGG - Exonic
1061154227 9:128847390-128847412 ACTCTGCCACCTGCATGGCCTGG - Intronic
1185955209 X:4481915-4481937 AATATGTCACCTTTATGTCAGGG - Intergenic
1192567057 X:72173756-72173778 ACTTTGTAACCTGGAGGCCCAGG - Intergenic
1194988736 X:100521434-100521456 ACTCTGGTATCTGTATGTCCTGG - Intergenic
1195794263 X:108626278-108626300 CCTTTGTCGCCTTTCTGTCCAGG - Exonic
1196279796 X:113810663-113810685 ACTTTGACATCTGTAACTCCAGG - Intergenic
1199833386 X:151565031-151565053 ACTTTGCCACCTGCCTTTCCTGG - Intronic
1199835676 X:151587754-151587776 ACTTTGCCACCTGCCTTTCCTGG + Intronic
1201264464 Y:12192757-12192779 ACTTTGTCACCCCTGTGGCCTGG - Intergenic
1202175586 Y:22096055-22096077 ATTTTGACACCTGCATGTCTTGG + Intergenic
1202215775 Y:22490327-22490349 ATTTTGACACCTGCATGTCTTGG - Intergenic