ID: 945184512

View in Genome Browser
Species Human (GRCh38)
Location 2:207125939-207125961
Sequence ATGTGTTGATAAGTTCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 196}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945184509_945184512 -6 Left 945184509 2:207125922-207125944 CCAAAAAATAGTATAAAATGTGT 0: 1
1: 0
2: 4
3: 66
4: 664
Right 945184512 2:207125939-207125961 ATGTGTTGATAAGTTCTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945184512 Original CRISPR ATGTGTTGATAAGTTCTTAG GGG Intronic
905440232 1:37991213-37991235 ATGTGTTCATATGTTCACAGCGG + Intergenic
906222841 1:44095894-44095916 ATTTGTTTATCAGTTCTGAGAGG + Intergenic
906889965 1:49700273-49700295 ATGTTTTTATATGTTCTTGGTGG - Intronic
906890047 1:49701985-49702007 ATGTTTTTATATGTTCTTGGTGG - Intronic
908712849 1:67037147-67037169 ATGTGTTGAAAAGTTGTTGTAGG + Intronic
911456867 1:98135961-98135983 ATGTGTTATAAAATTCTTAGAGG + Intergenic
911855087 1:102866649-102866671 ATGTTGTTATAAGTTCTTAAAGG + Intergenic
918324204 1:183394111-183394133 ACATGTTAATAAGTTATTAGTGG - Intronic
918946042 1:191066585-191066607 AGTTTTTGATAAGTTCTTATAGG + Intergenic
922636717 1:227180304-227180326 TTTTTTTGAAAAGTTCTTAGTGG - Intronic
1063277654 10:4588371-4588393 ATGTGTTTATAATTTCTTCCAGG - Intergenic
1066342111 10:34545397-34545419 ATCTGTTGACAAGTGCTTTGGGG - Intronic
1068280426 10:54861621-54861643 TTGTGTTGTTCAGTTCTTTGAGG - Intronic
1068296981 10:55083688-55083710 ATGTGTTTATCAGTTCTCATTGG - Intronic
1068718004 10:60209743-60209765 ATGTTTTGATACAGTCTTAGAGG + Intronic
1071215583 10:83396926-83396948 TTGTATTAATAAGCTCTTAGAGG + Intergenic
1071944467 10:90627053-90627075 ATGTATTTATAATTTTTTAGTGG - Intergenic
1072714901 10:97744526-97744548 ATGTGGTGATAAGGTCTATGAGG + Intronic
1073485195 10:103812914-103812936 TTGTGTGGATAAATTCTTAGCGG - Intronic
1074448548 10:113540221-113540243 ATGTGTTGATATCACCTTAGGGG - Intergenic
1074943217 10:118254981-118255003 ATTTGTTGAGAAGTTATTACAGG - Intergenic
1079529649 11:21435050-21435072 ATTTGTTGATTACTTCTAAGAGG + Intronic
1080240833 11:30125494-30125516 AAGTGTGGAGAACTTCTTAGTGG + Intergenic
1081783238 11:45728093-45728115 ATGTGTTGAAAAGGCTTTAGAGG - Intergenic
1083019152 11:59488673-59488695 ATGTAATGATAAGCTCTTGGCGG + Intergenic
1085144620 11:74182738-74182760 ACATGTTGAGAACTTCTTAGAGG + Intronic
1086141140 11:83501807-83501829 ATGTGGTGATATGTACTTAGTGG - Intronic
1087934769 11:104019661-104019683 TTGTGTTGAAAAGTTCTCTGAGG + Intronic
1089523389 11:119080695-119080717 AGGTGGTGATAAGTTCTGAGTGG + Intronic
1092326535 12:7537132-7537154 ATGTCTTGAAAAGTTGTTATAGG + Intergenic
1093374902 12:18413151-18413173 AAGTGTAGATAATTTCTTAATGG + Intronic
1094031613 12:26018522-26018544 ATGTGATTTTAATTTCTTAGAGG + Intronic
1094220766 12:27990773-27990795 ATGTGTTTATTAGTTCTAAAAGG - Intergenic
1098123353 12:67265939-67265961 TTCTGGTGATAAGATCTTAGAGG + Intergenic
1098669904 12:73213991-73214013 ATGTGTTTATTAGTTCTAACAGG + Intergenic
1099494108 12:83323751-83323773 ATGTTTTGATTTGTTCTTACGGG + Intergenic
1100071439 12:90724324-90724346 TTGTGTTGATATTTTGTTAGAGG - Intergenic
1100668036 12:96776929-96776951 AAGTATTGAAAAGTTCATAGTGG + Intronic
1100729787 12:97452168-97452190 ATTTGTTTATCAGTTCTAAGAGG + Intergenic
1102232143 12:111270015-111270037 ATGTTTTAATGATTTCTTAGGGG + Intronic
1103182002 12:118921021-118921043 TTATATGGATAAGTTCTTAGTGG - Intergenic
1106744664 13:32687816-32687838 ATGATTTGATAGGTTATTAGTGG + Intronic
1106954514 13:34921282-34921304 ATGTGGTGATAAGCTCTTTTGGG - Intergenic
1108616048 13:52133275-52133297 ATCTGTTGATGAGTTCAAAGCGG + Intronic
1109206337 13:59487047-59487069 ATGTATAGGCAAGTTCTTAGTGG - Intergenic
1109764488 13:66876089-66876111 ATGTATTGATAAGTGTCTAGTGG + Intronic
1110078591 13:71282257-71282279 ATTTGTTGATCAGTTCTAATAGG + Intergenic
1111957086 13:94771142-94771164 AGGTTTTGATGAGTTCTCAGAGG - Intergenic
1112090389 13:96077210-96077232 ATGTTTTGAAAAGTATTTAGAGG + Intergenic
1112801092 13:103110432-103110454 ATGTGCTGAGAGGTTCTAAGGGG - Intergenic
1116455092 14:45111065-45111087 ATTTGTTGATAATTTCTAAAGGG - Intronic
1117109631 14:52437323-52437345 ATTTGTTGATTAGTTCTAACAGG - Intronic
1118144853 14:63124276-63124298 GTGTCTTTATAAGATCTTAGGGG - Intergenic
1118449202 14:65882890-65882912 ATTTGTTTATCAGTTCTAAGAGG + Intergenic
1118822303 14:69353425-69353447 ATGTGTGGATGTGTTCTCAGCGG - Exonic
1118976709 14:70684115-70684137 TTGTTTTGATAAGTCCTAAGTGG + Intergenic
1119217868 14:72882982-72883004 CTGTGCTGATTAGTTCTCAGGGG + Intronic
1119857322 14:77910293-77910315 ATGGGGTGAAAAGTTCTGAGAGG + Intronic
1119965809 14:78914401-78914423 AGGTGGTGATAAGTTCGTTGGGG + Intronic
1123145024 14:106120906-106120928 ATGTATTTTTAAGTTCTTACTGG - Intergenic
1123471981 15:20562404-20562426 AGGTGTTGATCAGTGCTTGGTGG + Intergenic
1123646022 15:22437949-22437971 AGGTGTTGATCAGTGCTTGGTGG - Intergenic
1123732285 15:23157395-23157417 AGGTGTTGATCAGTGCTTGGTGG + Intergenic
1123750420 15:23354777-23354799 AGGTGTTGATCAGTGCTTGGTGG + Intronic
1123785055 15:23663282-23663304 ATATGTTGAAAAGTTCTTTGTGG + Intergenic
1124282790 15:28378693-28378715 AGGTGTTGATCAGTGCTTGGTGG + Exonic
1124299909 15:28532920-28532942 AGGTGTTGATCAGTGCTTGGTGG - Exonic
1127027543 15:54824298-54824320 ATTTGTTAATTAGTTTTTAGTGG + Intergenic
1128431690 15:67601909-67601931 ATGTGAACATAAGTTCTTAAAGG - Intronic
1130624866 15:85503848-85503870 ATGTGTTCATGAATTCTCAGGGG + Intronic
1131953656 15:97708106-97708128 AAGTTTTGAGAAGTTCCTAGAGG - Intergenic
1133252231 16:4490512-4490534 ATGTGTTTATTACTTCTTTGTGG - Intronic
1134164421 16:11918544-11918566 TTGTGTTGACATTTTCTTAGGGG - Intergenic
1136030260 16:27497642-27497664 ATGGGGTGATAATTTCTAAGCGG + Exonic
1136780381 16:32896855-32896877 ATGTATTTTTAAGTTCTTACTGG + Intergenic
1136890027 16:33962793-33962815 ATGTATTTTTAAGTTCTTACTGG - Intergenic
1139586962 16:67910138-67910160 ATGGGTTGAGAATTTCTTTGAGG + Intronic
1203083007 16_KI270728v1_random:1160821-1160843 ATGTATTTTTAAGTTCTTACTGG + Intergenic
1143815651 17:9511860-9511882 ATTTGTTTATCAGTTCTGAGAGG - Intronic
1144452491 17:15392552-15392574 ATGTGTTCATAACATCCTAGAGG + Intergenic
1147046773 17:37758261-37758283 AAGTGTTGCTAAGTTTTTAAAGG + Intergenic
1149515068 17:57275075-57275097 GTTAGTTGATAAGTCCTTAGAGG + Intronic
1149928065 17:60722437-60722459 ATGTGTTGATATCTTCTGTGAGG + Intronic
1153137407 18:1931849-1931871 TTCTGTTGATAAAATCTTAGAGG + Intergenic
1157996112 18:52558351-52558373 ATGTGTAGAGAAATTCTTAATGG - Intronic
1159715850 18:71821576-71821598 GTGTGTTGATATGTTGTTACAGG + Intergenic
1160057900 18:75502863-75502885 ATGTGTTTATCATTTCTTTGTGG - Intergenic
1160405381 18:78642484-78642506 ATTTGTTTATAAGTTATGAGTGG + Intergenic
1160630503 18:80244015-80244037 AGGCGTTGCTAAGTTCGTAGTGG + Intronic
1168064355 19:53910507-53910529 ATGTCTTGATTAGTTTGTAGGGG + Intronic
925208310 2:2026173-2026195 ATGTGTTTTTAAGTTTTAAGAGG - Intronic
926444063 2:12922453-12922475 ATGGGTTTATAAATTCTAAGAGG + Intergenic
927479780 2:23443257-23443279 ATGTGCTAAAAAGTACTTAGGGG - Intronic
928474339 2:31610757-31610779 ATTTGTTTATCAGTTCTTATAGG - Intergenic
928777015 2:34778119-34778141 ATGTGTGGAAAATTTCTAAGAGG + Intergenic
929480644 2:42304179-42304201 AGGTGTATATAAGTTCTTTGTGG + Intronic
932369557 2:71175997-71176019 ATGTGTTAATAAGTTCCCTGGGG + Intergenic
935900839 2:107791076-107791098 ATGTGTTTATTAGTTCTAATAGG - Intergenic
936510995 2:113146944-113146966 ATGTCTTGAAAAGTTGTTACAGG + Intergenic
939689951 2:145246253-145246275 ATGTATTGATAAATTCTGATTGG - Intergenic
939853512 2:147329175-147329197 ATCTGTTGAAAAGATATTAGTGG + Intergenic
941454371 2:165697652-165697674 ATTTGTTGATTTGTTCCTAGTGG + Intergenic
941502292 2:166294828-166294850 ATTTATTGATAATCTCTTAGAGG + Intronic
941571896 2:167181085-167181107 ATGTGTTGTTAGGTTTTTAAGGG - Intronic
942804964 2:179919726-179919748 ATGTGTTGGTAAATGCTTAAGGG - Intergenic
944104223 2:196062062-196062084 ATTTAGTGATAAGATCTTAGAGG - Intronic
945184512 2:207125939-207125961 ATGTGTTGATAAGTTCTTAGGGG + Intronic
1168945563 20:1753301-1753323 ATTTGTTTATTAGTTCTAAGAGG - Intergenic
1170921607 20:20684647-20684669 ATGTGTTGAGAACTCCTCAGTGG + Intronic
1172578612 20:36029180-36029202 ATGTGATGACTAATTCTTAGGGG - Intronic
1173135868 20:40438310-40438332 ATGAGTGGAAAAGTTGTTAGAGG - Intergenic
1173628466 20:44491514-44491536 ATGTCTGGATAAGTTGTTGGTGG + Exonic
1177550633 21:22616900-22616922 ATATGTTGATAATTTCATATAGG - Intergenic
1182543170 22:31056549-31056571 GTGTGTTGATCAGGTCTTATGGG + Intergenic
1183505135 22:38204536-38204558 ATGTGTTGTGGAGCTCTTAGAGG - Intronic
950130505 3:10541763-10541785 ATGTGTTGATTAGATTTTATTGG + Intronic
950812320 3:15660673-15660695 ATGTGTTTATGATCTCTTAGTGG + Intergenic
953069341 3:39503742-39503764 ATCTGTTTATAAGTTAGTAGTGG + Intronic
953199054 3:40761291-40761313 ATTTGTTTATCAGTTCTTTGTGG - Intergenic
953836135 3:46346326-46346348 ATTTGGTTATAAATTCTTAGAGG - Intergenic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
955165059 3:56502780-56502802 ATGTGTTCTTAGGTACTTAGGGG + Intergenic
956662067 3:71608827-71608849 ATTTGTTAAGAAGTTCTTATTGG + Intergenic
957420915 3:79968675-79968697 ATTTGTTGATCAGTTCTAAGGGG - Intergenic
957714070 3:83902412-83902434 ATGTGATGATATGTTCTGAGAGG - Intergenic
959000353 3:100956995-100957017 CTGTGATGGTAAGTTATTAGAGG + Intronic
959492682 3:107009969-107009991 ATTTGTTTATCAGTTCTGAGAGG - Intergenic
962555505 3:136546982-136547004 ATGAGTTGAGAAAATCTTAGTGG - Intronic
964687207 3:159409405-159409427 ATTTGTTGATCAGTTCTAATAGG - Intronic
965402557 3:168230085-168230107 ATTTGTTTATAAGATGTTAGAGG - Intergenic
965974020 3:174598871-174598893 ATGTGTTGAAAAGTCTTTTGTGG + Intronic
966824713 3:183953910-183953932 TTCTGTTGAGAAGTTCTTTGTGG - Intronic
972885662 4:43483504-43483526 ATTTGTTGATATTTTCTTATAGG - Intergenic
973794472 4:54410049-54410071 AATTGTTGGTATGTTCTTAGTGG + Intergenic
974074019 4:57152199-57152221 ATGTGTTGAAAAGGTCTAAAAGG - Intergenic
974763906 4:66315176-66315198 ATGTGTTGAAAACTACTTAAAGG - Intergenic
974792388 4:66709370-66709392 ATGTGTTGATAAAAGCTTTGTGG + Intergenic
974884025 4:67794012-67794034 ATCTGTTTTTAAGTTCCTAGTGG - Intergenic
974949129 4:68566746-68566768 ATGTGTATTTAAGTTCATAGTGG - Intronic
974958163 4:68668872-68668894 ATGTGTATTTAAGTTCATAGTGG - Intronic
975759030 4:77599699-77599721 CTGTGTGGAGAAGTCCTTAGTGG - Intronic
978382688 4:108146418-108146440 ATATGTTAATAACTTATTAGGGG - Intronic
979389510 4:120111227-120111249 ATGTGTAGATAAGTTATGAAAGG - Intergenic
980527027 4:134003346-134003368 AGATGATGATAAGTTCTAAGAGG - Intergenic
980554850 4:134389956-134389978 ATGTCTTGCTGAGTTCTTAAAGG + Intergenic
983271379 4:165566301-165566323 ATGTGTTGATGAGAGCATAGAGG + Intergenic
988503434 5:31801893-31801915 AGGGGTAGATAGGTTCTTAGAGG - Intronic
991440221 5:66639251-66639273 GTGTGTTGATTAGTACTGAGAGG + Intronic
992327034 5:75669908-75669930 ATTTATTGATAAGTTTTTAAAGG - Intronic
993130724 5:83895145-83895167 ATGAGTTGATAAGTTCTATATGG - Intergenic
993431461 5:87837323-87837345 ATATGTTTATCAGTTCTAAGAGG + Intergenic
996067525 5:119096022-119096044 ATAAGTTGATAACATCTTAGTGG - Intronic
996584969 5:125076874-125076896 ATATGTTGATTAGTTCTAACAGG - Intergenic
1001418642 5:171569267-171569289 ATGTGTTGATAATCTCATTGAGG + Intergenic
1001790298 5:174450810-174450832 ATTTGTTTATTAGTTCTAAGAGG - Intergenic
1002376440 5:178792291-178792313 ATGTGTGGATAAGTTCATGACGG - Intergenic
1002678731 5:180942065-180942087 ATTTGTTTATCAGTTCTAAGAGG - Intronic
1005426218 6:25705536-25705558 ATTTGTTTATAAGTTCTTGAAGG + Intergenic
1008069469 6:47085022-47085044 ATATCTTGATAAGTGCTTATAGG - Intergenic
1008162441 6:48095095-48095117 ATGTGTTGATAGTTTCATAGAGG + Intergenic
1009440874 6:63676701-63676723 ATGTGTTGGGAAGGTTTTAGAGG + Intronic
1011825984 6:91305993-91306015 ATGTGTTGATAAGAGCTGAAAGG + Intergenic
1014041021 6:116825356-116825378 ATTTGTTTATAAGCTCTAAGAGG - Intronic
1016194914 6:141323405-141323427 ATATGTTTATGATTTCTTAGTGG + Intergenic
1016962273 6:149685293-149685315 ATTTGTAGATAAATTATTAGAGG + Intronic
1023211557 7:37810941-37810963 ATTTGTTGATAATTGCTTTGTGG - Intronic
1026001988 7:66567007-66567029 TTGTGTTGGTAAGTTCTTTTAGG + Intergenic
1026030810 7:66792248-66792270 TTGTGTTGGTAAGTTCTTTTAGG - Intronic
1027407690 7:77879214-77879236 TTGTATTTATAACTTCTTAGAGG + Intronic
1028625682 7:92874569-92874591 ATGTGTTGAAAAATTTCTAGAGG + Intergenic
1029646162 7:101857359-101857381 ATGTATTGAAAAGTACTTGGTGG - Intronic
1029902193 7:104053288-104053310 ATGAGTTGATAATTTATGAGTGG + Intergenic
1030504779 7:110407732-110407754 ATATGTTGATATGTGCTAAGTGG - Intergenic
1030909744 7:115232330-115232352 ATTTGTTGCTAGGTTCTTATTGG + Intergenic
1031440848 7:121792862-121792884 AGGTCTTGATAAGATCTCAGTGG + Intergenic
1031526717 7:122830923-122830945 ATTTGTTTTTAAGTTCTGAGTGG - Intronic
1032967327 7:137114422-137114444 ATGTGTATTTAAGTTCTTTGTGG + Intergenic
1033018422 7:137696498-137696520 ATGAGTTCACAAGTTCTCAGGGG - Intronic
1034352047 7:150422642-150422664 CTGTGTTGATAATTTCGAAGCGG + Intergenic
1036220124 8:6914450-6914472 AGGTGTTGATGAGGTCTGAGTGG - Intergenic
1040584726 8:48728024-48728046 ATGTGTTGAGGAGATCTAAGTGG + Intronic
1042129507 8:65573690-65573712 ATTTGTTCATCAGTTCTAAGAGG + Intergenic
1042986211 8:74585892-74585914 ATAAGATGATAAATTCTTAGAGG - Intergenic
1043107925 8:76138377-76138399 ATGAGTCGATAGGTTTTTAGTGG - Intergenic
1047011482 8:120677543-120677565 ATGTGTTAAGAATTTTTTAGAGG - Intronic
1048151357 8:131897976-131897998 ATTTGTTGATAACTTCTGATTGG + Intergenic
1049400657 8:142425530-142425552 ATGTGTTGGGAAGTTTTCAGTGG - Intergenic
1052178387 9:25494059-25494081 ATGTGTTCATAAGTGCTGATGGG - Intergenic
1052456451 9:28705290-28705312 ATGTGGTGGTAAGATGTTAGGGG + Intergenic
1052478060 9:28987050-28987072 ATTTGTTTATAAGTTCTAACAGG + Intergenic
1052523478 9:29581942-29581964 AAGTGTTGATTAGATCTTATTGG - Intergenic
1054829589 9:69608678-69608700 AAGTGGTGATAAAGTCTTAGAGG + Intronic
1055601794 9:77927113-77927135 TTGTGTTGAAAAGATCTTGGGGG - Intronic
1059562131 9:115346068-115346090 ATGTGTTTATAAGTCCTTCATGG - Intronic
1059787496 9:117601477-117601499 ATTTGTTTATCAGTTCTAAGAGG - Intergenic
1186903770 X:14088530-14088552 AAGTGTAGAGAAGTTCTTTGTGG + Intergenic
1190842192 X:54155575-54155597 ATGTGTAGACAAGTCTTTAGAGG + Intronic
1191905413 X:66082997-66083019 ATGTGTTGGTAATTTAATAGGGG - Intergenic
1192103713 X:68292843-68292865 CTGTGGTGATAAGCCCTTAGAGG - Intronic
1194479723 X:94406037-94406059 ATTTGTTGAAACATTCTTAGTGG + Intergenic
1195752344 X:108171518-108171540 ATGTGTTCAAAAGATCTCAGTGG - Intronic
1196302329 X:114061636-114061658 ATGTGTTGATAAGGTGTCACAGG - Intergenic
1196369154 X:114956461-114956483 ATATGTTGATAAGCTGTTGGGGG + Intergenic
1201933920 Y:19385919-19385941 ATGTTTTGACAAGGTCTTTGTGG + Intergenic