ID: 945187463

View in Genome Browser
Species Human (GRCh38)
Location 2:207154194-207154216
Sequence GCAGCTTATGAGAGTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945187463_945187465 1 Left 945187463 2:207154194-207154216 CCTGATTCACTCTCATAAGCTGC 0: 1
1: 0
2: 0
3: 12
4: 140
Right 945187465 2:207154218-207154240 GTAAGCTCAGTCATCAGGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 76
945187463_945187467 14 Left 945187463 2:207154194-207154216 CCTGATTCACTCTCATAAGCTGC 0: 1
1: 0
2: 0
3: 12
4: 140
Right 945187467 2:207154231-207154253 TCAGGTAAGGCAGAAATGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 228
945187463_945187468 26 Left 945187463 2:207154194-207154216 CCTGATTCACTCTCATAAGCTGC 0: 1
1: 0
2: 0
3: 12
4: 140
Right 945187468 2:207154243-207154265 GAAATGGCAGGTGTAGTAACCGG 0: 1
1: 0
2: 0
3: 8
4: 144
945187463_945187466 10 Left 945187463 2:207154194-207154216 CCTGATTCACTCTCATAAGCTGC 0: 1
1: 0
2: 0
3: 12
4: 140
Right 945187466 2:207154227-207154249 GTCATCAGGTAAGGCAGAAATGG 0: 1
1: 3
2: 23
3: 31
4: 297
945187463_945187464 -4 Left 945187463 2:207154194-207154216 CCTGATTCACTCTCATAAGCTGC 0: 1
1: 0
2: 0
3: 12
4: 140
Right 945187464 2:207154213-207154235 CTGCAGTAAGCTCAGTCATCAGG 0: 1
1: 0
2: 2
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945187463 Original CRISPR GCAGCTTATGAGAGTGAATC AGG (reversed) Intronic
907117861 1:51985466-51985488 GCAGTTTAAGAGTGTGAAGCTGG - Intronic
908734429 1:67261216-67261238 GATGCTTCTGAGAGTGAATGAGG - Intergenic
909238692 1:73183861-73183883 GCAGGTAATGAGAATGAGTCAGG - Intergenic
912208194 1:107531418-107531440 CCAGCTTCTAAGAGTGATTCTGG - Intergenic
913826366 1:123160894-123160916 GCAGTTTCTGAGAATGATTCTGG - Intergenic
913879111 1:124106586-124106608 GCAGTTTCTGAGAATGATTCTGG - Intergenic
915662191 1:157413725-157413747 GCAGCTTGTGTGACTGAGTCTGG - Intergenic
917581814 1:176386556-176386578 GCACTTTAGGAGAGTGAAGCAGG + Intergenic
923428667 1:233897729-233897751 GCAGCCTAAGAGAGAGAATGTGG + Intergenic
1063273849 10:4541881-4541903 GCAGCTTCTGAGAGTGATAAAGG - Intergenic
1065280235 10:24129907-24129929 GCAGCCTATGATCATGAATCTGG - Intronic
1066843598 10:39966544-39966566 GCAGTTTCTGAGAATGATTCTGG - Intergenic
1067380897 10:45772367-45772389 GCACTTTAAAAGAGTGAATCTGG + Intronic
1067380899 10:45772414-45772436 GCACTTTAAAAGAGTGAATCTGG + Intronic
1067888597 10:50113021-50113043 GCACTTTAAAAGAGTGAATCTGG + Intronic
1067888599 10:50113066-50113088 GCACTTTAAAAGAGTGAATCTGG + Intronic
1069225238 10:65935024-65935046 GCTGCTCATGGGAGTGAATAGGG - Intronic
1070282275 10:75058548-75058570 GCTGGTTATGAGAGAGAAGCAGG + Intergenic
1073175556 10:101554544-101554566 GCTGCTTAAGAGAGAGGATCAGG + Exonic
1074551898 10:114451515-114451537 GCTGCTTTTGAGAGTAAAACTGG - Intronic
1075304381 10:121354911-121354933 GCAGCTTAGCAGGGTGATTCTGG + Intergenic
1079915640 11:26365559-26365581 GCAGAGTATAAGAGTGAAGCAGG - Intronic
1080917179 11:36672143-36672165 CCAGGTAATGAGAGTGAATAGGG + Intergenic
1080990363 11:37527482-37527504 ACAGCCTATGAGAATGAATTAGG + Intergenic
1083240674 11:61385829-61385851 ACAGGTACTGAGAGTGAATCTGG + Intergenic
1083511065 11:63209837-63209859 GGAGCATAGGAGAGTTAATCAGG + Intronic
1085729452 11:78983817-78983839 GCAGCTCATGAGAGGGAGGCAGG + Intronic
1090425788 11:126606257-126606279 GGTGTTTATGAGAGTGGATCTGG + Intronic
1091580569 12:1785940-1785962 ACAGCTGATGAGAGTGAAACTGG - Exonic
1092524552 12:9301777-9301799 GCAGCTCATGAGTGTGGAGCTGG + Intergenic
1092542713 12:9430035-9430057 GCAGCTCATGAGTGTGGAGCTGG - Intergenic
1094510298 12:31092393-31092415 GCAGCTCATGAGTGTGGAGCTGG + Intronic
1094583788 12:31758491-31758513 GCAGGTAATGGGAATGAATCAGG - Intergenic
1096611924 12:52807699-52807721 GGAGCTCATGAGTGTGAAGCTGG - Exonic
1097966355 12:65585670-65585692 GTAGCTAATGAGAGTGGAGCTGG - Intergenic
1102240926 12:111324236-111324258 GCTGCTTAGGAGACTGAAGCGGG + Intronic
1111659260 13:91189202-91189224 GGAGCTTATCAGTGTGAATAGGG - Intergenic
1112426608 13:99307863-99307885 ACAGCTTATGAGAAAGAAACAGG + Intronic
1118345490 14:64937748-64937770 GCATCATATGAGAGTGAATGTGG - Intronic
1120034727 14:79683618-79683640 GCAGCTTAGTTGAGTGATTCTGG + Intronic
1123165355 14:106320396-106320418 GCAGCCTCTGTGAGTGACTCAGG + Intergenic
1125158201 15:36613718-36613740 GCTGCTGATGAGAGTGAGACAGG + Intronic
1126225669 15:46266268-46266290 TGAGCTTATGAGAGTTTATCAGG - Intergenic
1127108945 15:55646951-55646973 GCTGGTGATGAGAATGAATCAGG - Intronic
1130396277 15:83504745-83504767 GCAGCTTAGGTGGGTGATTCTGG - Intronic
1131383552 15:91983975-91983997 GGAGCTTGTGAGAGTGGATGTGG + Intronic
1131443033 15:92473046-92473068 GCATCTTATGAGAGTCAGCCAGG + Exonic
1134241518 16:12510331-12510353 GCAGCAGATGAGAGAGAGTCAGG + Intronic
1136608992 16:31355036-31355058 TCATCTGATGAGAGTGACTCCGG + Intergenic
1140063484 16:71590741-71590763 GCAGATTCTGGAAGTGAATCTGG - Intergenic
1140139959 16:72246109-72246131 TTAGCCGATGAGAGTGAATCTGG - Intergenic
1141022357 16:80509313-80509335 GCAACATATTAGTGTGAATCAGG - Intergenic
1151839218 17:76605478-76605500 TCTGCTTTTGAGAGTGTATCAGG + Intergenic
1151894434 17:76970408-76970430 GCAGGTGATCAGAATGAATCAGG - Intergenic
1153758032 18:8302886-8302908 GCAGCTTATGAGTTTGATTTGGG + Intronic
1155523159 18:26689548-26689570 GCAGCATATCAGAGTGAAAAAGG + Intergenic
1155908867 18:31486105-31486127 GTAGCTTCGGAGAGTGAACCTGG - Intergenic
1156849692 18:41712096-41712118 GGAGCCTTTGAGAGAGAATCAGG + Intergenic
1159469093 18:68826213-68826235 GCAGCCTATGAGAGAGACTCAGG - Intronic
1164015804 19:21255074-21255096 GGAGCATAGGAGAGTTAATCAGG + Intronic
1165731869 19:38151110-38151132 GCAGCTTATGATGTTAAATCTGG + Intronic
1166118566 19:40670776-40670798 GCAGCTTCTGAGAGTGTGACTGG + Intronic
930394519 2:50803932-50803954 GAAGTTTATGAGAGTGATACAGG - Intronic
931425790 2:62169848-62169870 GCAGATGATCAGAGTGAGTCAGG - Intergenic
937335650 2:121060745-121060767 GCAGCTCATGACAGAGCATCCGG - Intergenic
939214519 2:139218946-139218968 GCATTTTATCAGAGTGAATGGGG + Intergenic
941082744 2:161080714-161080736 GAAGCTTAGGAGAGCGGATCAGG - Intergenic
941584834 2:167344838-167344860 GCAGATTTTGAGAATAAATCTGG - Intergenic
944442443 2:199756178-199756200 GCAGGTAATGAGAGACAATCTGG + Intergenic
945187463 2:207154194-207154216 GCAGCTTATGAGAGTGAATCAGG - Intronic
945950479 2:216034629-216034651 GCAGCGTGTGAGAGTGCAACTGG + Intronic
947335260 2:229075976-229075998 GCTGCTTCTGGAAGTGAATCAGG - Intronic
947408231 2:229804168-229804190 ACAGCTTATGAAAGAGGATCCGG - Exonic
947442070 2:230132144-230132166 CCAGCTCATGACAGTGACTCTGG - Intergenic
947795734 2:232892884-232892906 GCAGCTGCTGTGAGTGTATCCGG - Exonic
1169589470 20:7124230-7124252 GCTGCTTATGAGAGAGGAGCTGG + Intergenic
1169806837 20:9568248-9568270 GCAGCTTATCACAGTTAATGTGG + Intronic
1170809267 20:19660993-19661015 GCAGCAAATGAGAGTGTAACCGG - Intronic
1172109314 20:32536208-32536230 GCAGCCTAGGACAGGGAATCGGG + Intronic
1177689555 21:24487493-24487515 GCAACTTATGAGATTCACTCAGG - Intergenic
950401829 3:12774982-12775004 GCACCTTTTGGGAGTGAATGAGG - Intergenic
950855597 3:16101717-16101739 GCAGTTGATGAGAATGAGTCTGG + Intergenic
953937289 3:47056610-47056632 GCAGCTTAGCAGGGTGGATCTGG - Intronic
956388627 3:68747939-68747961 GAAGCATATGAGAGTGAGTGGGG - Intronic
958217162 3:90600920-90600942 GCAGTTTCTGAGAATGAATCTGG + Intergenic
959175496 3:102904474-102904496 GCAGGTGATCAGAATGAATCAGG + Intergenic
962065008 3:131970416-131970438 GCAGCTAATGAGACTTAATGGGG - Intronic
964016969 3:151959838-151959860 ACATCTTAAGAGAGTGAATCAGG + Intergenic
965148403 3:164937599-164937621 GCAGCTTGTGAGAGCGAATAGGG - Intergenic
967594915 3:191317210-191317232 GCAGCTGAGGAGAGTGCACCAGG - Intronic
972057671 4:34825137-34825159 GCAGAATACCAGAGTGAATCTGG - Intergenic
973171363 4:47148064-47148086 GGAGCTTATTATAGTAAATCAGG + Intronic
973807228 4:54538180-54538202 GGAGCCTGTGAGAGTGGATCAGG + Intergenic
974931135 4:68362560-68362582 ACAGCTGATGAGAGTAAATAGGG + Intergenic
974994499 4:69137842-69137864 ACAGTTTATGATACTGAATCAGG - Intronic
976033164 4:80783078-80783100 GCAGCTTATTTGAGTAATTCTGG + Intronic
976036459 4:80828615-80828637 GGAGCAAATGAGAGAGAATCAGG - Intronic
979101649 4:116624378-116624400 GCAGCTTAAGAGAATGTATCTGG + Intergenic
983018232 4:162641156-162641178 TCTTCTTATGAGAGAGAATCAGG + Intergenic
985902404 5:2806692-2806714 GCAGCCTCTGAGAGTGACACAGG + Intergenic
986647096 5:9928115-9928137 GCAGCTCTAGAGAGTGAATCAGG + Intergenic
987800746 5:22693349-22693371 GCAGCTTGTGAGAGTGTGTGGGG + Intronic
989263140 5:39441799-39441821 GCTGCTTATGAGAAGGCATCAGG + Intronic
989388635 5:40877831-40877853 GCAGGTAATCAGAGTGAGTCAGG + Intergenic
989388642 5:40877887-40877909 GCAGGTAATCAGAATGAATCAGG + Intergenic
992251400 5:74879385-74879407 TCAACATATGAAAGTGAATCAGG - Intergenic
992386445 5:76289278-76289300 TCAGCTAAGGAGAGTGAATAGGG - Intronic
996282039 5:121741721-121741743 GCAGCTTAACAGAGTGGCTCTGG + Intergenic
996903211 5:128567612-128567634 GTAGCTTTAGAGAATGAATCCGG - Intronic
997962735 5:138335012-138335034 ACTGCTTATCACAGTGAATCAGG - Intronic
999017884 5:148128364-148128386 GTAGCTTATGAGGGAGAATGAGG - Intronic
999353394 5:150900005-150900027 GCAGCTTGACAGAGTGAATATGG - Intronic
1004405234 6:15327027-15327049 ACAGCTTTTGAGAGTGAAGGTGG + Intronic
1005592476 6:27343294-27343316 GCTACTCATGAGACTGAATCAGG - Intergenic
1005753480 6:28904606-28904628 GCAGATTATCAGAGAGGATCAGG + Exonic
1009248149 6:61265038-61265060 GAAGCTTTTGAGAGTGAAAGGGG - Intergenic
1009386830 6:63094949-63094971 GCAGCCAATGAGAGAGACTCAGG - Intergenic
1009922598 6:70080914-70080936 GGAGCTTATGCAAGTGAATGTGG + Intronic
1010041268 6:71387670-71387692 TCAACTTATCAGAATGAATCAGG - Intergenic
1013737704 6:113247335-113247357 GCAGCTTATCTGAGTGATTCTGG + Intergenic
1015970604 6:138739473-138739495 GCAGCATATTAGAGTAACTCTGG - Intergenic
1018572302 6:165224416-165224438 TCAGCCTCTCAGAGTGAATCTGG - Intergenic
1022779542 7:33565331-33565353 GCAACTTATGTGACAGAATCAGG - Intronic
1026496880 7:70911244-70911266 GCAGCTTATGGCAATGAATTGGG + Intergenic
1033645942 7:143304466-143304488 CCAGCTTAAGAAAGTGAATATGG - Intronic
1034189616 7:149203992-149204014 GCAGCTTAGGTGAGTGGGTCTGG + Intronic
1035883490 8:3267761-3267783 GCAGCTGATGGGAGTGGAGCGGG + Intronic
1040579521 8:48685909-48685931 GCAGCTGGTGATAGTGAACCAGG - Intergenic
1045520615 8:102899923-102899945 GCAGCTGATGAGTAGGAATCTGG + Intronic
1048283159 8:133120376-133120398 GCAGCCTATGAAAGTGATCCAGG - Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049957719 9:708839-708861 GCAGCTTATTAGCGTGGCTCTGG + Intronic
1051095894 9:13464717-13464739 GTAGCTTATCAGAGTGATTCTGG - Intergenic
1054872145 9:70057358-70057380 GCAGCTTTTGAGAGAGGATGAGG + Intronic
1054945798 9:70794711-70794733 GCACATGCTGAGAGTGAATCAGG - Intronic
1055412004 9:76040635-76040657 ATAGCTTATGAAAGTGAGTCTGG + Intronic
1055739545 9:79371481-79371503 TGATCTTATCAGAGTGAATCAGG - Intergenic
1056114111 9:83425432-83425454 CTAGCTTGTGAGAGTGAATGGGG + Intronic
1059037675 9:110775258-110775280 GCAGCTTATAGGAGGGCATCTGG - Intronic
1060565803 9:124590432-124590454 GGAGCTTTTGAGAGTGACTGGGG - Intronic
1060571577 9:124645343-124645365 GCAGATTGTTAGAGTGAATCAGG + Intronic
1188565784 X:31524540-31524562 GAATCTTATCAGAGTGAAACCGG - Intronic
1188908943 X:35822254-35822276 GGAGGTTATGATAGTAAATCAGG - Intergenic
1190723892 X:53173869-53173891 GCAGCTTATGCATGTGAATATGG - Intergenic
1191136061 X:57066789-57066811 GCATTTTATTAGAGTGAAGCAGG + Intergenic
1191758738 X:64624248-64624270 GGAACTGATGAGAGTCAATCAGG + Intergenic
1193146001 X:78076259-78076281 GCAGGTAATCAGAGTGAGTCAGG + Intronic
1194616951 X:96116280-96116302 GGAGCTTATAAGAGGGAAACAGG + Intergenic
1196875000 X:120148727-120148749 GGAGCATAGGAGAGTTAATCAGG + Intergenic
1201277694 Y:12314077-12314099 GGAGCATAGGAGAGTTAATCAGG + Intergenic
1201357583 Y:13113384-13113406 GGAGCATAGGAGAGTTAATCAGG + Intergenic
1201560876 Y:15315252-15315274 GCAGGTTATGAGTGGGAACCAGG + Intergenic
1202093326 Y:21217104-21217126 GCAACTCAGGAGAGTGAGTCAGG - Intergenic