ID: 945187838

View in Genome Browser
Species Human (GRCh38)
Location 2:207157631-207157653
Sequence CTGGGGTGATGGTGGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 1, 2: 5, 3: 53, 4: 442}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945187830_945187838 3 Left 945187830 2:207157605-207157627 CCATGAACAGTTTGAAAGCAGGC 0: 1
1: 0
2: 0
3: 11
4: 180
Right 945187838 2:207157631-207157653 CTGGGGTGATGGTGGCAAAAAGG 0: 1
1: 1
2: 5
3: 53
4: 442
945187828_945187838 27 Left 945187828 2:207157581-207157603 CCTCATGCTATGTATAAGAGGGA 0: 1
1: 0
2: 0
3: 14
4: 114
Right 945187838 2:207157631-207157653 CTGGGGTGATGGTGGCAAAAAGG 0: 1
1: 1
2: 5
3: 53
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945187838 Original CRISPR CTGGGGTGATGGTGGCAAAA AGG Intronic
900388785 1:2424354-2424376 ATGGGGAGATGATGGCCAAAGGG - Intergenic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900430178 1:2597651-2597673 CTGGGGTGAGGGTGGAGACAAGG - Intronic
901117868 1:6863301-6863323 ATGGGGAGATGGTGGTCAAAGGG - Intronic
901217170 1:7561330-7561352 CTGGGGTGATGGAGGGACAGAGG + Intronic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
902710410 1:18235641-18235663 AGGGGGTGATGTTGGAAAAATGG + Intronic
902874764 1:19334172-19334194 CTGGGGTTATGATGGCCAACAGG - Intergenic
903246924 1:22022983-22023005 CTGGGGTCATGGTGGTGACAGGG + Intergenic
904080330 1:27868630-27868652 CAGGCGCGACGGTGGCAAAAGGG - Intergenic
904376950 1:30087595-30087617 CTGGGGTGAGGATGGAAAAGAGG - Intergenic
906419030 1:45647837-45647859 CTGGGGTGGTGGTAGGGAAATGG + Intronic
906682764 1:47741611-47741633 CTGGGGAGATTGTGGAGAAAAGG + Intergenic
906833916 1:49062197-49062219 ATGGGTTGCTGGTGCCAAAAAGG + Intronic
908175527 1:61552117-61552139 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
909615744 1:77606219-77606241 CTGTGGTGATGGTGGCCATGGGG + Intronic
910354649 1:86341170-86341192 CTGGGGTGAGGGTGGAAGAGAGG - Intergenic
911419710 1:97624966-97624988 ATGGGGTGATGATGGTCAAAGGG + Intronic
911669691 1:100593697-100593719 CAGTGGTGATGGTGGCCACAGGG - Intergenic
911840328 1:102674762-102674784 CTGGGATGATGAAGGCAACAGGG - Intergenic
911887810 1:103326439-103326461 CTGGGGTGATGGTGACTATGGGG - Intergenic
912247442 1:107974807-107974829 ATGGGGAGATGTTGGCCAAAGGG + Intergenic
912587010 1:110776315-110776337 CTGGGGTGAAGCTGGAAAGAAGG - Intergenic
913417748 1:118630403-118630425 ATGGGGTGATTGTGGTGAAAAGG - Intergenic
915346086 1:155197660-155197682 CTGGGGTGGGGGTGGGATAAAGG + Intronic
915440163 1:155940970-155940992 TTGGGGTGTTTGTGGCAGAAGGG - Intergenic
916360624 1:163963151-163963173 CTGGGGTGGTGGTGGCCATAGGG + Intergenic
916657006 1:166885199-166885221 TTGTGGTTATTGTGGCAAAATGG - Intergenic
918356041 1:183707251-183707273 CTGGGGTGAGGGTGGAAGAGAGG + Intronic
918356235 1:183708485-183708507 CTGGGGTGAGGGTGGAAGAGAGG - Intronic
918635449 1:186768822-186768844 TTGAGGTGGTGGTGGAAAAAAGG + Intergenic
919336672 1:196244578-196244600 CTGGAGTGGTGGTGGCCACAGGG + Intronic
920744963 1:208617531-208617553 CTGGGGTGGTGGTGGCTACAGGG + Intergenic
921127763 1:212193184-212193206 ATGGGGAGATGTTGGCCAAAGGG - Intergenic
921134691 1:212249569-212249591 CTGGGTTGAGGCTGGGAAAATGG + Intergenic
921969760 1:221135355-221135377 CAGGGGTGATGTGTGCAAAATGG - Intergenic
922087642 1:222366150-222366172 TTGGGGTGCTGGTGGCACAAGGG - Intergenic
922796575 1:228342504-228342526 CAGGGCTGATTGTGGCCAAAGGG + Intronic
923522805 1:234749089-234749111 CTGGGTTGGTGGTGGGAACAGGG + Intergenic
924490767 1:244535525-244535547 CTGTGGTGGTGGTGGCCACAGGG - Intronic
924795209 1:247287904-247287926 CTGGGGTGAGGGTGGAAGACAGG - Intergenic
1065098158 10:22303165-22303187 CAGAGGTGAAGGTAGCAAAAAGG - Intergenic
1066650823 10:37653401-37653423 ATGGGGTGACTGTGGGAAAAAGG + Intergenic
1067977286 10:51041088-51041110 GTGGGGTGGTGGTGGCCACAGGG - Intronic
1068103896 10:52590722-52590744 CTGTGGTGGTGGTGGCCAAGGGG - Intergenic
1069244613 10:66188371-66188393 CAGGGGTGAGGGTGGGGAAATGG - Intronic
1069448822 10:68499495-68499517 CTTCGGTGATGGCCGCAAAAGGG - Intronic
1070238056 10:74651084-74651106 TTGGGGTGGTGGTGGGGAAATGG + Intronic
1070445259 10:76493267-76493289 CTGTGGTAATGGTGACAATAGGG - Intronic
1071767864 10:88689357-88689379 CTGGGGTGGTGGTGGCCATGGGG + Intergenic
1071963034 10:90824750-90824772 CTGGGGTAATGGTGGCTATGGGG + Intronic
1072326753 10:94306404-94306426 CTAGGGTGAGGGAGACAAAAGGG - Intronic
1072546724 10:96445753-96445775 CTGGCGTGCTGCTGGCGAAAGGG - Intronic
1072660975 10:97363335-97363357 CAGGGGTAATGGTGGCAAAGAGG + Intronic
1075210712 10:120488751-120488773 CTGAGGTGAGGGTGGGACAATGG - Intronic
1077574571 11:3372468-3372490 CTGGTGTGATATTGGCCAAAAGG + Intronic
1078003977 11:7518605-7518627 CTGGGGTGAGGGTGGAAGAGGGG + Intronic
1078109728 11:8382688-8382710 CTGGGGTGGCGGTGGGAAACAGG - Intergenic
1078344396 11:10532436-10532458 GTTGGGAGATGGTGGGAAAAGGG - Intronic
1078473291 11:11609284-11609306 GCAGGGTGATGGTGGGAAAAGGG - Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079260266 11:18871854-18871876 CATGGGTGATGTTAGCAAAAGGG + Intergenic
1080290671 11:30667444-30667466 CTAGGGTGATGGTGGTGAGATGG + Intergenic
1081633794 11:44707312-44707334 CTTGCCTCATGGTGGCAAAATGG - Intergenic
1081940786 11:46939701-46939723 CTGGGCAGATGGAGGCAAAGGGG - Intronic
1083313201 11:61796515-61796537 CTGGGGTGAAGGAGGTATAATGG - Exonic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1087049118 11:93868369-93868391 CTGGGGTGAGGGTGGAAGAGAGG + Intergenic
1087201373 11:95347463-95347485 CTGGGGTGGTGGTGGCTATGGGG + Intergenic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1088642913 11:111890585-111890607 ATGGTGTGATATTGGCAAAAAGG - Intergenic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1091136873 11:133199200-133199222 GTGGGGAGAGGGTGGCAAGAGGG + Intronic
1091280386 11:134378588-134378610 CTGGGGTGAGGGTGGCACCCAGG - Intronic
1093177792 12:15932825-15932847 CTGGGGAGATGTTGGTCAAAGGG - Intronic
1093991161 12:25591384-25591406 CTGTGGTGGTGGTGGCCACAGGG + Intronic
1094380712 12:29840397-29840419 CTGTGGTGATGGTGACCAAGGGG - Intergenic
1096293770 12:50365615-50365637 CTTTGGAGATGGCGGCAAAAGGG - Intronic
1096716991 12:53497615-53497637 CTGAGGTGATGCTGGGAAGAAGG - Intronic
1097181368 12:57173883-57173905 CTGAGGTGTTGTTGGCACAAGGG - Exonic
1097182649 12:57180024-57180046 CTGGGGGGAGGGTGCCAAGAGGG - Intronic
1097496078 12:60336876-60336898 ATGGGGTGATGTTGGTCAAAGGG - Intergenic
1097508680 12:60507955-60507977 ATGGTGTGATGGAGGCAACATGG + Intergenic
1097676687 12:62610645-62610667 CTGGGGAGATGTTGGCTAAAGGG - Intergenic
1098016996 12:66115447-66115469 CTGGGGTGTGGGTGTCAGAAAGG + Intergenic
1098702106 12:73642273-73642295 ATGGGGAGATGTTGGTAAAAGGG - Intergenic
1099208050 12:79750583-79750605 CCAGAGTGAAGGTGGCAAAAGGG + Intergenic
1099861398 12:88229118-88229140 CTGGGGTGAGGGTGGAAGAGAGG - Intergenic
1100277073 12:93081240-93081262 CTGGGGTGGTGGTGGCAGGGAGG - Intergenic
1101463700 12:104925047-104925069 CTTTGGTGATGGGGACAAAAAGG + Intronic
1101937788 12:109072236-109072258 GTGGGGTGAGGGTGGTGAAAGGG + Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103264323 12:119616187-119616209 CTAGGCTCATGTTGGCAAAACGG - Intronic
1104742229 12:131186452-131186474 CTGGTGTGAATGTGGAAAAAGGG + Intergenic
1105589842 13:21781964-21781986 CTTGGGAGATGTTGGTAAAAGGG - Intergenic
1105593654 13:21816611-21816633 CTAGGTAGATGGTGGTAAAATGG + Intergenic
1106013628 13:25847905-25847927 CTGGGGTGCTGCTGGGCAAAGGG - Intronic
1106277398 13:28225127-28225149 CTGAGGTTATGGTGCCAAATTGG + Intronic
1106987439 13:35372322-35372344 CTGTGGTGGTAGTGGCAAATTGG + Intronic
1107585652 13:41845328-41845350 CTGGCGAGATTGTGGAAAAAAGG + Intronic
1109402832 13:61857654-61857676 CTGGGGTGGTGGTGACCACAGGG - Intergenic
1109522694 13:63533843-63533865 CTGGGGTGGTGGTGGCTATTGGG - Intergenic
1109900701 13:68765735-68765757 ATGGGAAGATGATGGCAAAACGG + Intergenic
1110324099 13:74194195-74194217 CTGGGGTGGTGGTGGTGAAAAGG + Intergenic
1111076861 13:83248562-83248584 CTGGAGCAGTGGTGGCAAAAAGG - Intergenic
1111840398 13:93442355-93442377 CTAGGGTGATGCTGGTAGAAAGG + Intronic
1112653036 13:101418979-101419001 CTGGGGACATGGAGGCAAATGGG - Intergenic
1112943844 13:104899735-104899757 TTGGGGAGATGTTGGCCAAAGGG + Intergenic
1113100256 13:106710080-106710102 CTGGGGAGATGGAAGCACAAAGG + Intergenic
1113171196 13:107505154-107505176 CTGGGGTGATGGCAGCACCATGG + Intronic
1113637259 13:111928231-111928253 CTGGGATGATGGTGGAGAACGGG + Intergenic
1114237402 14:20834889-20834911 CTGGGGTGAGGGTGGAAGAGAGG + Intergenic
1114306304 14:21426229-21426251 CAGGAGTGATGGTGCTAAAAAGG + Exonic
1114434598 14:22694550-22694572 CTTCAGTGATGGTCGCAAAAGGG + Intergenic
1114587146 14:23825581-23825603 ATGGGGTGAGGGTGGGAAATGGG - Intergenic
1116321853 14:43478326-43478348 CTGAGATCATGGTGCCAAAATGG + Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1118406196 14:65426088-65426110 ATGGGGAGATGTTGGCCAAAGGG - Intronic
1120821970 14:88920024-88920046 CTGGGGTGGTGGTGGAAATGTGG + Intergenic
1121901981 14:97701599-97701621 CTGGGGTGAGGGTGGAGAAATGG + Intergenic
1123106176 14:105842287-105842309 CTGGGGAGATGTTGGTCAAAGGG - Intergenic
1123188071 14:106539129-106539151 CTGGGGTAATGGTAGAAGAAGGG - Intergenic
1125672308 15:41482993-41483015 GTGGGGAGGTGGTGGCAAAGTGG - Exonic
1125776329 15:42218550-42218572 CTGGGGAGATGTTGGTCAAAGGG - Intronic
1125844559 15:42839582-42839604 CTGGTGAGATGGTGGTGAAAAGG - Intronic
1126100579 15:45116076-45116098 GTGGGATGAGGGTGGGAAAATGG - Intronic
1126285750 15:47008980-47009002 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
1126583705 15:50263099-50263121 CTGGGGTGTTGGTGGCCAAGTGG + Intronic
1127170946 15:56300241-56300263 CTGGGGTGATGATGGCCATGAGG + Intronic
1127256118 15:57295184-57295206 CTGGGGAGATGTTGGTCAAAGGG + Intronic
1127322064 15:57856516-57856538 GTGGGGTGATGGTGCACAAAGGG + Intergenic
1127783392 15:62335468-62335490 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
1129260688 15:74365639-74365661 CTGGGATGGTGGTGGGTAAAAGG - Intronic
1129536551 15:76317823-76317845 CTGGTGTGGTGGCGGCAATAGGG + Intergenic
1129875619 15:78973613-78973635 CTGGGGTGGTGGGGGCAACATGG + Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130539124 15:84809268-84809290 GGGAGGTGATGGTGGGAAAAGGG + Intergenic
1132738548 16:1399252-1399274 CGGGGATGATGGTGCCACAAGGG + Intronic
1133204947 16:4227609-4227631 CGATGGTGGTGGTGGCAAAATGG + Intronic
1133972558 16:10578407-10578429 CTGGGGTGAGGGTGGAGAAGCGG + Intronic
1133988541 16:10687092-10687114 TTGGGGAGATGGTGGTCAAAGGG + Intronic
1134159400 16:11874105-11874127 CTGGGGTGGAGGTGGGAATAAGG + Intronic
1134406977 16:13969560-13969582 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
1134663912 16:16004437-16004459 CTGAGGTGATGGCTGAAAAAAGG - Intronic
1136499455 16:30662757-30662779 CTGGGGTGGGGGTGGCAGACTGG - Exonic
1136778635 16:32884343-32884365 CTGGGGTGGGGGTGGCAAAAGGG + Intergenic
1136891985 16:33977171-33977193 CTGGGGTGGGGGTGGCAAAAGGG - Intergenic
1137478162 16:48828764-48828786 GTGGGTTGGTGGGGGCAAAAAGG + Intergenic
1137786318 16:51140457-51140479 CTGGGGGGCTGGTGGCAGAATGG + Exonic
1138048073 16:53746833-53746855 TTGGGGAGATGATGGCCAAAAGG - Intronic
1140646584 16:77038124-77038146 CTGTGGTGGTGGTGGCTAAGGGG - Intergenic
1141679445 16:85535761-85535783 TAGGGGTGAGGGTGGAAAAATGG - Intergenic
1203081051 16_KI270728v1_random:1146437-1146459 CTGGGGTGGGGGTGGCAAAAGGG + Intergenic
1142562688 17:820201-820223 CTGTGATGATGGTGGTAACATGG + Intronic
1142864104 17:2779913-2779935 CTGGGGTGGTGGTAACCAAATGG + Intronic
1143375503 17:6464561-6464583 GTGGGGTGAGGGTGTCAAGAGGG - Intronic
1143668913 17:8383166-8383188 CTTCGGTGATGGCCGCAAAAGGG + Exonic
1143728272 17:8865243-8865265 CTGGGGGGATGGGGGCACAAGGG - Intronic
1144832272 17:18138392-18138414 CTGGGGTGATTGAGGCCAGATGG + Intronic
1145255568 17:21320345-21320367 ATGGGGTGATGCTGGAAGAATGG - Intergenic
1145321045 17:21767604-21767626 ATGGGGTGATGCTGGAAGAATGG + Intergenic
1147037482 17:37692554-37692576 CTGGGGTGCTGCTTGGAAAATGG + Intronic
1147045032 17:37745431-37745453 CTGGGGTGCTCGTGGAAGAAGGG + Intergenic
1147773115 17:42881295-42881317 ATGGGGTGAGGGTGGCAGAATGG + Intergenic
1147901268 17:43786674-43786696 CTGAGGTGACTGTGGCTAAAAGG - Exonic
1147906143 17:43824471-43824493 CTGGGGAGATGGAAGCAAAGAGG - Intronic
1148385601 17:47232467-47232489 CTGTGGTTATGTTGGCAAAGAGG + Intergenic
1149108567 17:52997954-52997976 CTGGGGTGGTGGTGGCTACAGGG + Intergenic
1149369600 17:55979688-55979710 ATTGGGTGATGCTGGCCAAAGGG - Intergenic
1150912616 17:69404566-69404588 CTGAGGTGATGATGACAAACTGG + Intergenic
1151932609 17:77242028-77242050 TTCTGGTGATGGTGGCCAAAGGG - Intergenic
1152629415 17:81403385-81403407 CTGGGGTTATTGTGGGAGAAAGG + Intronic
1153045945 18:855962-855984 ATGGTGAGATGGTGGCATAAAGG + Intergenic
1153627784 18:7038314-7038336 CTGGGGTGATGGGTTCAACAGGG - Intronic
1153817531 18:8803673-8803695 TTGGGGTGAAGGTGGCCAAAGGG - Intronic
1154411616 18:14144988-14145010 CTGGGGTGCTGCAGGCAAAGGGG + Intergenic
1155588301 18:27394552-27394574 ATGGGGTGATTGTGGTATAATGG + Intergenic
1155758470 18:29532973-29532995 CTGGCATGATTGTGGAAAAAAGG + Intergenic
1156341852 18:36216624-36216646 TTGGCATGATGGTTGCAAAATGG - Intronic
1158260821 18:55604264-55604286 CTGGGGTGGGGGTGGGAGAATGG - Intronic
1158308922 18:56138113-56138135 CTAGGGCTATGGTGGCAGAAAGG + Intergenic
1159023509 18:63162461-63162483 CTTTGGTGATGGTGGAATAAAGG - Intronic
1159183317 18:64939093-64939115 CTGGGATGGTGATGGCAACACGG + Intergenic
1159264655 18:66064764-66064786 CAGATGTGATGGTAGCAAAATGG + Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159802532 18:72919354-72919376 CTAGGGTGGTGGTGGCCACAGGG - Intergenic
1159821024 18:73143697-73143719 ATGGGGTGATGTTGGTCAAAGGG - Intergenic
1159893634 18:73975936-73975958 CTGGGATTATGGTGGAGAAAAGG - Intergenic
1160181578 18:76641411-76641433 GTGGGGAGATGCTGGTAAAAGGG - Intergenic
1161958187 19:7507800-7507822 CTGGGGAGAGGTGGGCAAAAAGG - Intronic
1162181856 19:8874957-8874979 ATGGGGTGATGCTGGTCAAAGGG + Intronic
1162706296 19:12557129-12557151 CTGGGTTGATGGAGACAGAAAGG + Intronic
1163267066 19:16227867-16227889 AAGGGGTGGTGGTGGCCAAAGGG - Intronic
1163892700 19:20030975-20030997 CTGGGGTGAGGCTGACAAGAGGG - Intronic
1164237020 19:23346243-23346265 CTGGGGAGAGGGTGGCAGAGAGG - Intronic
1164934966 19:32202967-32202989 CTGGGGAGATGGTGATGAAAAGG - Intergenic
1165941133 19:39415304-39415326 CTGGGGTTATGGGGGCCAAGGGG - Intronic
1166300320 19:41909020-41909042 CTGGGGTGCTGGGGGCACAGTGG - Intronic
1166671641 19:44713553-44713575 GTGGGGTGAAGGTGGTAATATGG - Intergenic
1166851581 19:45763948-45763970 CTGGGGAGACGGTGGCAGGATGG - Intronic
1167100497 19:47401707-47401729 CTGGGGAGAGGATGGCAAAGGGG + Intergenic
1167293772 19:48637831-48637853 GGGGGGTGATGGGGGGAAAAGGG + Intergenic
1167405031 19:49301177-49301199 ATGGGGTGATGTGGGCAAAATGG - Intronic
1167420455 19:49399572-49399594 CTGGGGTGTTGGGGGCAGAAGGG - Intronic
925506289 2:4568861-4568883 CTGGGGTGATGTTGGCCACAGGG - Intergenic
926121644 2:10244222-10244244 TTGGGGTGATGGTGGGGAACTGG + Intergenic
926516318 2:13851020-13851042 CTGGGGTGGTGGTGGCCACAGGG + Intergenic
927309733 2:21617173-21617195 CTGGGGTCATGGTGGCTACGGGG - Intergenic
928282448 2:29960792-29960814 CTGGTGAGACTGTGGCAAAAAGG + Intergenic
928291009 2:30037406-30037428 CTGGAATGATGGTGGCCAGATGG - Intergenic
928484158 2:31712323-31712345 CTGGGGTGGTGGTAGCCACAGGG + Intergenic
928715486 2:34055662-34055684 CTGGGGTCGTGGTGGCCACAGGG - Intergenic
932771808 2:74504637-74504659 CTTGGGGGATGGGGACAAAAAGG - Intergenic
933168287 2:79097834-79097856 CTGGGGTGAGGGTGGAAGAGAGG + Intergenic
934554694 2:95281161-95281183 CTGGGGTGAGGGTGGGACAGAGG + Intronic
934560670 2:95311715-95311737 CAGAGGTGGTGGTGGCAAAAGGG - Intronic
934875959 2:97920292-97920314 CTTGGGTGGGGGTGGCAAAGGGG + Intronic
935133727 2:100280283-100280305 AGGGGGTGATGCTGGCAAAGGGG + Exonic
935182114 2:100700747-100700769 CTGGGGTGATGGAGGGACATCGG - Intergenic
936465890 2:112749899-112749921 CTGGGGTGATGAAAGCAAATAGG - Intronic
937197568 2:120173273-120173295 CTGGGGAGAGGGTGGAAGAAAGG + Intronic
937570249 2:123349143-123349165 CTAGGGGGATGGTAGCTAAAGGG + Intergenic
937762125 2:125617096-125617118 CTGAGGAGGTGTTGGCAAAAGGG + Intergenic
939405019 2:141745446-141745468 CTGTGGTGGTGGTGGCCATAGGG - Intronic
940498107 2:154459289-154459311 CTTGGGAGTTGGTGGGAAAAGGG + Intergenic
940550677 2:155152122-155152144 CTGGGGTGAGGGTGGCAAGGCGG + Intergenic
940738536 2:157480571-157480593 CTGTGGTGACGGTGGCCAAGAGG + Intronic
941839832 2:170069569-170069591 ATGGGGAGATGTTGGCCAAAGGG - Intronic
942226099 2:173817422-173817444 CTTGGGTGAAGGAGGTAAAAAGG + Intergenic
942521132 2:176805453-176805475 CTGGGGCAATGGTTGCAACATGG - Intergenic
942700381 2:178701151-178701173 TTCGGGTGTTGGTAGCAAAAGGG + Exonic
943016020 2:182511728-182511750 CTGGGGAGAGGCTGGCAAACAGG - Intronic
944246038 2:197531393-197531415 CGGTGGTGATGGTTGCACAATGG - Intronic
944489810 2:200246693-200246715 ATGGCCTCATGGTGGCAAAATGG + Intergenic
945154915 2:206828397-206828419 CTGCGGTGGTGGTGGGGAAAGGG - Intergenic
945187838 2:207157631-207157653 CTGGGGTGATGGTGGCAAAAAGG + Intronic
945752227 2:213802249-213802271 CTGGGGTGAAGATGGCAATCTGG + Intronic
945831741 2:214795554-214795576 AAGGGGTGATGATGCCAAAAAGG + Intronic
946016789 2:216610452-216610474 CTGGGGAGATGGTTTCAAACGGG + Intergenic
946026563 2:216675230-216675252 AGAGGGAGATGGTGGCAAAAAGG - Exonic
946278481 2:218648755-218648777 CTGGGTTGAAGGTGGCAAAGGGG + Exonic
947108807 2:226696671-226696693 CAGGGGTGATGGTGGTAGAGGGG - Intergenic
948243906 2:236462140-236462162 TGGGGCTGATGGTAGCAAAATGG + Intronic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
948274923 2:236701036-236701058 CAGGGGTCATGATGGCAAACTGG + Intergenic
948783156 2:240337321-240337343 CTGGGGTGGTGGGGGCACATGGG - Intergenic
1168835464 20:874427-874449 CAGAGGTGGTGGTGGCAGAAGGG + Intronic
1168887390 20:1268963-1268985 GGGTGGTGATGTTGGCAAAAAGG + Intronic
1168912183 20:1457574-1457596 ATGGGGAGATGGTGGTCAAAGGG - Intronic
1170791107 20:19510358-19510380 ATGGGGTGGAGGTGGCAGAAGGG - Intronic
1172547676 20:35774028-35774050 CTGGGGTGTCGGTGGGGAAATGG + Intronic
1172965052 20:38828604-38828626 CTGCAGGGATGGTGGCAACAAGG + Intronic
1173386754 20:42595446-42595468 CTGGTGAGAGGGTAGCAAAATGG + Intronic
1173843765 20:46175315-46175337 CTGGGGTGGAGGTGGCCAATGGG + Intronic
1174681268 20:52411125-52411147 CTGGTGTGGGGGTGGCAAAAGGG - Intergenic
1174721039 20:52812676-52812698 CTGGGGTGCTGTTACCAAAAGGG + Intergenic
1174945574 20:54981479-54981501 GTGTGGTGACTGTGGCAAAATGG - Intergenic
1174951604 20:55047749-55047771 CTGGGGATATGGTGGTAAAAGGG + Intergenic
1175277133 20:57779828-57779850 CTGAGGTTATGGGGGCAAAGGGG + Intergenic
1175393963 20:58645977-58645999 CTGGTATGATGGTGACATAAGGG + Intergenic
1175603882 20:60296824-60296846 CCGGGGTGATGGTGCCACTACGG - Intergenic
1175632127 20:60550183-60550205 CTGGGCTGGTGGTGGCCATAGGG - Intergenic
1175668311 20:60879200-60879222 CTGGAGCGATGGTGGCAACCTGG - Intergenic
1176062873 20:63179898-63179920 CTGGGGTGGGGGTGGGAAGATGG - Intergenic
1176861439 21:14013437-14013459 CTGGGGTGCTGCAGGCAAAGGGG - Intergenic
1177456367 21:21344505-21344527 CTGGGGTGGTGGTGGCTACAGGG + Intronic
1177651006 21:23962015-23962037 CGGGGGTGGTGGTGGCAAGAAGG + Intergenic
1177858208 21:26423050-26423072 AGGGGGTCATGGTGGAAAAAAGG + Intergenic
1178040932 21:28640276-28640298 CTGGGGAGATGGAGACACAATGG + Intergenic
1178129737 21:29558642-29558664 CTTGGGTGAGGTTGGCCAAAAGG + Intronic
1179609220 21:42538814-42538836 CTGGGGACCTGGTGGCATAAGGG - Intronic
1180007454 21:45029423-45029445 CTGGGGTGCTGGAGGCAAGCGGG + Intergenic
1180870523 22:19144201-19144223 CTGGAAGGATGGTGGCAAAGAGG - Intronic
1181065307 22:20303047-20303069 CTGTGGTGCTGGTGGCACAGGGG + Intergenic
1181636721 22:24177975-24177997 CAGGGGTGAAGGTGGCAGAGGGG + Intronic
1182279149 22:29208206-29208228 CTGGGGTGTGGGTGGCAGGAAGG - Intronic
1182356409 22:29724112-29724134 GTGGGGTGCTGATGGCACAACGG + Intronic
1183720771 22:39560181-39560203 GTGGGGTGAAGGTGGCAGAGAGG - Intergenic
1184081301 22:42222470-42222492 GGGGTGTGATGGTGTCAAAATGG - Intronic
1185159901 22:49217401-49217423 CTGGGGTGATGGTGGATTAGCGG - Intergenic
1185366585 22:50439639-50439661 CTGGGGTGCTGCAGGCAAAGGGG - Intronic
949348742 3:3102069-3102091 CTGGGGAGATGGTGCTCAAAGGG - Intronic
949747884 3:7315893-7315915 CAGGTGTGATGTTAGCAAAATGG - Intronic
949829206 3:8196584-8196606 CTGGGGTGGTGGTGGCCACAGGG - Intergenic
950006356 3:9693988-9694010 CTTCCCTGATGGTGGCAAAATGG + Intronic
950017856 3:9766980-9767002 CTGGGGGGAGAGTGGAAAAAGGG - Intronic
950791196 3:15473820-15473842 CTGGGGAGAGGGTGGCAGGATGG - Intronic
952070181 3:29625117-29625139 CTGGGGAGGTGAAGGCAAAAAGG - Intronic
952222011 3:31332477-31332499 CTGTGGTGGTGGTGGCCATAGGG + Intergenic
952254289 3:31682198-31682220 CGGGGGTAATGGTGGAAACAAGG - Intronic
952609838 3:35195065-35195087 CTGGAGTTATGTTAGCAAAAAGG + Intergenic
953024114 3:39134995-39135017 TGGGGGTGATGGTGGTAAGAAGG - Intronic
954205733 3:49057525-49057547 CTGGGATGGTGGTGGGGAAAGGG + Exonic
954899315 3:54005544-54005566 CTGGGATGTGGGTGGCAAACAGG + Intergenic
955881157 3:63547482-63547504 GTGAGGTGCTGGTGGCATAAAGG + Intronic
956622360 3:71234082-71234104 TTGGGGAGATGGAGGCAGAAGGG + Intronic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
958917331 3:100064329-100064351 CTGGGGAGCTGGTGGCAAATTGG - Intronic
959127566 3:102308294-102308316 CTGGGATAGTGGTGGCCAAAAGG + Intronic
960180206 3:114567015-114567037 CTGGTGTGATGGTTGCATAGGGG + Intronic
961592396 3:127990647-127990669 GTGCGGTGCTGGTGCCAAAAAGG - Intergenic
963490740 3:145997130-145997152 ATGGGCTGATGGTGGGAGAAGGG - Intergenic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
964202988 3:154139156-154139178 TTGGGGTGATGGTGGGTAAGAGG + Intronic
965050465 3:163640832-163640854 TTGGGGTGATGGTTGAAAAGGGG + Intergenic
965250875 3:166342585-166342607 CTGTGGTGATGGTTGCCACAGGG + Intergenic
965415134 3:168384136-168384158 CTGTGGTGATAGTGGCCACAGGG - Intergenic
965541021 3:169871433-169871455 CTGGGGTGATGGTGGAATCAGGG - Intergenic
966491134 3:180529733-180529755 CTGGGGTGGTGGTGGCTACAAGG + Intergenic
966533667 3:181007833-181007855 CTCTGGTGTTGGTGCCAAAAAGG + Intergenic
967016701 3:185488774-185488796 CTGGGGTGATATGGGCAAGATGG - Exonic
967357019 3:188582979-188583001 TTGGGGCGATGGTGGGGAAATGG - Intronic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968449236 4:667332-667354 CTGGGGAGAAGGTGGGACAAGGG + Intronic
968713336 4:2136793-2136815 CTGGGGAGGTGGTGGAAATAAGG + Intronic
970071171 4:12161812-12161834 CTGATGTGATGGTGGCTACAGGG - Intergenic
970793691 4:19888956-19888978 CTGGGGTGAGGGTGGAAGACAGG - Intergenic
970987022 4:22170845-22170867 ATGGAGTGATGGGAGCAAAAAGG + Intergenic
971217659 4:24675930-24675952 CTGGGCTGAGGGTGGCAGGAAGG - Intergenic
971608399 4:28688143-28688165 TTGGGGTGATGGTGGTATAGTGG - Intergenic
972148636 4:36061785-36061807 CTGGTGAGATTGTGGCGAAAAGG - Intronic
972271024 4:37510971-37510993 CTGTGGTGGTGGTGGCAATGGGG - Intronic
972469605 4:39391210-39391232 CTGTGGTGATGGAGGCTGAAGGG - Intergenic
973822130 4:54671017-54671039 TAGGGCTGATGGTGGCTAAATGG - Intronic
973919754 4:55673284-55673306 CTGCGGTGGTGGTGGCCACAGGG - Intergenic
974950262 4:68577997-68578019 CTGGGGTGAGGGTGGAAGAGAGG - Intronic
975365528 4:73523869-73523891 CTGTGGTGGTGGTGGCCATAGGG - Intergenic
975369450 4:73568014-73568036 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
975375906 4:73645747-73645769 CTGTGGTGGTGGTGGCAATGGGG - Intergenic
976300162 4:83509047-83509069 CTGGGGTGAGGGTGGAAGAGAGG + Intronic
976442455 4:85090663-85090685 CTGGGGAGATGCTGGCAAAAGGG + Intergenic
977051096 4:92129264-92129286 CTTGGGTGATTGTGGCAAGTGGG - Intergenic
977317764 4:95472364-95472386 CCTGGGAGATAGTGGCAAAAAGG - Intronic
977397017 4:96484041-96484063 CTGCGGTGATGGTGGCAATGGGG - Intergenic
977658064 4:99546932-99546954 CTAGGATGTTGGTGGCAAGAAGG - Exonic
977753408 4:100635796-100635818 CTAGGGTGGTGGTGGCTAAAAGG + Intronic
978465320 4:109002552-109002574 ATGGGGAGATGTTGGTAAAAGGG + Intronic
979395086 4:120178129-120178151 CTGGGGTGGTGGTGGCCATGGGG + Intergenic
980596984 4:134966959-134966981 CTGGGGTGGTAGTGGCCATAGGG + Intergenic
980657731 4:135811702-135811724 CTGGTGTGGTGGTGGCCACAGGG + Intergenic
980880673 4:138707208-138707230 CTGGTGTAATGCTGGGAAAAGGG - Intergenic
981836919 4:149065046-149065068 CTGGGGTGGTGCTGGCCACAGGG + Intergenic
981947287 4:150362657-150362679 TTGGGGAGGTGGTGGCCAAAAGG - Intronic
983017285 4:162628729-162628751 CTGGGGTGGTGGTGGTCAGAGGG + Intergenic
983221321 4:165046832-165046854 GTGGGGAGATGCTGGTAAAACGG + Intergenic
984878286 4:184388850-184388872 CTGGGGTCATGGAGGAAGAAAGG + Exonic
985204266 4:187517395-187517417 GTTGGTTGATTGTGGCAAAATGG + Intergenic
985818115 5:2141772-2141794 CTGGGGTTATGGGGACAACAAGG - Intergenic
986492773 5:8308802-8308824 CTGGGGTGGTGGTGGCTATGAGG + Intergenic
986989538 5:13535400-13535422 CAGGGGTCATGGAGGCTAAATGG + Intergenic
987536269 5:19192289-19192311 TTGGAGTGGTGATGGCAAAAGGG + Intergenic
987569555 5:19638794-19638816 ATGGGATGATGCGGGCAAAATGG - Intronic
987823156 5:22991742-22991764 CTGTGGTGATGGTGGCTACAGGG + Intergenic
988929114 5:36018574-36018596 TTAGGATGATGGTTGCAAAATGG + Intergenic
989427858 5:41316734-41316756 CTAGGGTGGTGGTGGCTATAGGG + Intronic
989585926 5:43073844-43073866 CTGGGGTGAGGGTGGAAGAGAGG + Intronic
990184920 5:53202124-53202146 CTGGGGTGAGGGTGGAAGAGAGG - Intergenic
990933070 5:61115176-61115198 CTGGGGTGGTGGTGGCCATGGGG - Intronic
991237805 5:64419267-64419289 CTGTGGTGGTGGTGGCCACAGGG + Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
992864674 5:80945841-80945863 ATGGGGTGATGGGGGGGAAAAGG + Intergenic
993580474 5:89653953-89653975 CTGGGGTGATGGTGGCTATGGGG + Intergenic
993606362 5:89995023-89995045 CTGGTGTGATTGAGGCAATATGG + Intergenic
996013645 5:118507607-118507629 CTGGGGTGATAATGGCAGACAGG - Intergenic
996576215 5:124978871-124978893 CTGGAGTGCATGTGGCAAAATGG - Intergenic
996681868 5:126236601-126236623 CTGTGATGATGGTGCCAAAGTGG + Intergenic
996920078 5:128757798-128757820 ATGGGATTATGGTGGCAAGATGG - Intronic
998273464 5:140728505-140728527 TAGTGGTGATGGTTGCAAAACGG - Intergenic
999019819 5:148153041-148153063 TGTGGGTGATGGTGGGAAAAAGG + Intergenic
999590862 5:153143760-153143782 CTGTGGTGGTGGTGGCAAGTTGG - Intergenic
1000159810 5:158586620-158586642 CTGTGGTGGTGGTGGCTACAGGG - Intergenic
1001020130 5:168175723-168175745 CTGGGGTTATGCTGGAAAAGAGG + Intronic
1001897178 5:175392607-175392629 CTGGGATGATAGTGGAGAAAGGG - Intergenic
1003013271 6:2446692-2446714 CTGGGGAGATGCTGGTCAAAGGG - Intergenic
1006301314 6:33194830-33194852 CTGGGGTGGAGGTGGGAGAAGGG + Intronic
1007730333 6:43941573-43941595 CTGGAGTGAAGGAGGCAAAGGGG + Intergenic
1010483524 6:76382346-76382368 CTGGGGTGGTGGTGACTACAGGG - Intergenic
1012019089 6:93893495-93893517 CTGGGATGACAGTGGAAAAAAGG + Intergenic
1012073483 6:94653894-94653916 TTTGGGAGATGGTGGCAAGAGGG + Intergenic
1012678991 6:102154376-102154398 CTGGGGTGGTGGTGGCTAAGAGG + Intergenic
1012690174 6:102300352-102300374 CTGGCGTGAGGGTGGCAAGAGGG - Intergenic
1014074436 6:117220184-117220206 CTCAGGTGATGGTGGTAGAAGGG + Intergenic
1014862313 6:126484892-126484914 CTGGGCTGGTGGTGGCCAAGGGG + Intergenic
1015030361 6:128587008-128587030 CTGGGGTGGTGGTGGCAATGGGG + Intergenic
1016292200 6:142538268-142538290 CTGGGGTGAGGGTGGAAGAGAGG - Intergenic
1016457321 6:144244849-144244871 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1016842039 6:148534304-148534326 CTGGAGTGATGGTGGGAGAGAGG - Intronic
1017046534 6:150351970-150351992 CTGGGGTGATGGTTGTGAAAAGG - Intergenic
1017479620 6:154838838-154838860 CTGGAATGATGGGGTCAAAAAGG - Intronic
1017528789 6:155266921-155266943 CTGGGGTGGTGGTGGGAGAGGGG + Intronic
1017935932 6:159005058-159005080 GTGGAATGATGTTGGCAAAAAGG + Intergenic
1021589383 7:22243904-22243926 CTGGGGAGATGTTGACCAAAGGG - Intronic
1022250369 7:28601228-28601250 GTGGGGTGGTGGTGGAAAAGGGG + Intronic
1022292158 7:29015262-29015284 ATGTGGTGATGGTGGCAAGGCGG - Intronic
1022741080 7:33122493-33122515 CTGTGGTGGTGGTGGCCACAGGG - Intergenic
1022950376 7:35332563-35332585 CTGTGGTGATAGGGGCAAAGGGG + Intergenic
1023304369 7:38808766-38808788 CTGGGGTTTTGGTGGCTAGAAGG - Intronic
1023993889 7:45146839-45146861 CTGGGGTGGAGGTGGCAGCAAGG + Intergenic
1024202205 7:47118952-47118974 CTGGGGAGATGTTGGTCAAAGGG - Intergenic
1024410891 7:49039600-49039622 CTGGGGTGGTGGTGGCTACAAGG + Intergenic
1024559348 7:50630236-50630258 CTGGGGTGGTGGTTCCAAAGAGG + Intronic
1025800219 7:64780024-64780046 CTGTGGTGGTGGTGGCAATGGGG - Intergenic
1026197545 7:68185944-68185966 CTGGGCAGCAGGTGGCAAAATGG + Intergenic
1027392689 7:77721094-77721116 CTTGGGTGGTGGTGGAAGAAAGG + Intronic
1027726498 7:81812271-81812293 CTAGAGTGATGTTGGCACAATGG - Intergenic
1027726565 7:81813178-81813200 CTAGAGTGATGTTGGCACAATGG - Intergenic
1028266527 7:88733278-88733300 CTTGGGTGATGGTGGCCATGGGG - Intergenic
1028972648 7:96875839-96875861 CTGGGATGGTGGTGGCCATAGGG + Intergenic
1029531153 7:101126323-101126345 GTGGGGTGGTGGTGGCTGAACGG - Intergenic
1029797260 7:102909164-102909186 CTGGGGTGGCGGTGGCTACAGGG - Intronic
1029803651 7:102975348-102975370 CTGGGGTGAGGGTGGAAGAGAGG - Intronic
1030301164 7:107976353-107976375 CTGGTGTGGTGGTGGGAATATGG - Intronic
1030431550 7:109455314-109455336 CTGTGGTGATGGTGGCCATGGGG - Intergenic
1030727822 7:112946864-112946886 ATGGGGAGATGGAGGTAAAAGGG - Intergenic
1031546128 7:123053271-123053293 CTGGGGTGGTGGTGACCACAGGG - Intergenic
1031639067 7:124140028-124140050 CAGGGGTGATGGTGGCTACAGGG - Intergenic
1031905876 7:127458953-127458975 CTGGGGTGGTGGCGGCCACAGGG + Intergenic
1033314011 7:140283126-140283148 CTGGGGTGGTGGTTGCACAGCGG - Intergenic
1034290708 7:149929095-149929117 TTATGGTGATGGTTGCAAAATGG - Intergenic
1034660365 7:152763752-152763774 TTATGGTGATGGTTGCAAAATGG + Intronic
1035041117 7:155928218-155928240 ATGGGGAGATGTTGGCCAAAGGG - Intergenic
1035381215 7:158442203-158442225 CAGTGGTGATGGTGGCAGCAAGG + Intronic
1037277064 8:17191939-17191961 CTGGTGAGATGGTGGAGAAAAGG - Intronic
1037403044 8:18512908-18512930 ATGGGGAGATGTTGGCTAAAGGG - Intergenic
1037889161 8:22614201-22614223 CTTGGATGATGGAGGGAAAAGGG - Exonic
1040095751 8:43440690-43440712 CTGGTGTGGTGGTGGCAATGAGG + Intergenic
1040704942 8:50114534-50114556 CTGGGGAAATGTTGGCCAAAGGG + Intronic
1041982222 8:63875435-63875457 CTGGGGAGAATGTGGAAAAAAGG - Intergenic
1042157908 8:65864951-65864973 CTGGGGTGAGGGTGGAAGAGAGG - Intergenic
1042511139 8:69612485-69612507 TTGGCGTGAATGTGGCAAAAAGG - Intronic
1043869313 8:85413900-85413922 ATGGGGTGATGTTGGTCAAAGGG - Intronic
1043967315 8:86494065-86494087 ATGGGGTGATGTTGGTCAAATGG + Intronic
1044747885 8:95388859-95388881 CTGGGGACATAGTGGCAAACAGG + Intergenic
1045064576 8:98434302-98434324 CTGCAGGGATGGTGGCTAAAGGG - Intronic
1046227115 8:111296697-111296719 CTGCAGTGATGGTGTCACAAGGG + Intergenic
1046509468 8:115183548-115183570 GTGGGGTGACTGTGACAAAAGGG - Intergenic
1047210287 8:122835047-122835069 CTGGGGTGAGGGTGGAAGAGAGG + Intronic
1048360130 8:133690564-133690586 TTGTGTTCATGGTGGCAAAATGG + Intergenic
1049332166 8:142060335-142060357 CTGCGGTGGTGGAGGCAAAATGG + Intergenic
1050084494 9:1950383-1950405 CGGGGGTGGGGGTGGCTAAAAGG + Intergenic
1050612553 9:7368017-7368039 GTGGGGAGATGGTGGTCAAAGGG + Intergenic
1051144795 9:14015650-14015672 CTGGGGTGGAGCTGGCTAAATGG - Intergenic
1051770420 9:20572223-20572245 ATGGGGAGATGTTGGCCAAAGGG + Intronic
1052094020 9:24362628-24362650 CTGGGGTGATGGTGGGTATGAGG + Intergenic
1052161343 9:25263899-25263921 CCGAGGTTCTGGTGGCAAAATGG - Intergenic
1052458484 9:28731834-28731856 CTTGGGGGATGCTGGGAAAAGGG + Intergenic
1053285867 9:36849169-36849191 CTGGGGTGAGGGTGGCACACAGG - Intronic
1053544936 9:39013186-39013208 ATGGGGAGATGTTGGCTAAAGGG + Intergenic
1055442330 9:76348770-76348792 CTGGGGAGATGCTGGTCAAAGGG - Intronic
1056007323 9:82285992-82286014 CTGGGGTGGTGGTGGCTTCAGGG + Intergenic
1056516806 9:87359809-87359831 CTGGGGTAGTGGTGGCCACAGGG + Intergenic
1056988452 9:91387535-91387557 CTGGGAAGCTGATGGCAAAAGGG - Intergenic
1058003994 9:99896022-99896044 CTGGGGTGGTGGTGGCCATGGGG + Intergenic
1059450922 9:114371017-114371039 CTGGGGGGGAGGTGGCAACATGG + Intronic
1059515436 9:114889862-114889884 CTGGGGTGGTGGTGGCTACTGGG + Intergenic
1060550692 9:124483698-124483720 CAGTGGTGATGGTGGCAGAGTGG - Intronic
1060677722 9:125530870-125530892 CTGGCATGATAGTGGCAATAGGG + Intronic
1061980747 9:134102115-134102137 CTGGGGAAATGGAGGCAAAGGGG + Intergenic
1062332061 9:136049207-136049229 CTGGAGAGGTGGTGGCAAAGGGG + Intronic
1185449610 X:275393-275415 CTGGGGTGAGGGAGGAAACAGGG + Intergenic
1186377572 X:9020948-9020970 TTGGGGAGATGTTGGCCAAAGGG - Intergenic
1188110195 X:26188403-26188425 CTGGGGGGATGGGGGAATAAGGG + Intergenic
1188911623 X:35854816-35854838 CTGGGATGTTGGAAGCAAAATGG + Intergenic
1188972262 X:36632570-36632592 CTGTGGTGATGGTGGACACAAGG - Intergenic
1189411833 X:40779570-40779592 CTGGGGTGATGGTGGCTACAGGG - Intergenic
1189875638 X:45433528-45433550 CTGGGGTGGTGGTGGCCATGGGG - Intergenic
1190530434 X:51369034-51369056 CGGGGGTGGTGGTGGCTACAGGG + Intergenic
1190602650 X:52108444-52108466 CTGGGGTGGTGGTGGCTATGGGG - Intergenic
1190746326 X:53324479-53324501 CTGGAGTGTGGGTGGCAAAATGG + Intergenic
1190808289 X:53860625-53860647 CTGGGGTGATGGTGGTCATGGGG - Intergenic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191593176 X:62911949-62911971 CTGGGGTGGTGGTGGCCACAGGG - Intergenic
1191703796 X:64071242-64071264 CTGTGGTGGTGGTGGCAACAGGG + Intergenic
1191725388 X:64274913-64274935 ATGGGGAGATGTTGGCCAAAGGG + Intronic
1191946891 X:66544334-66544356 CTGTGGTGATGGTGGCAAAAGGG - Intergenic
1192282694 X:69701981-69702003 CTGGGGTGAGGGTGGAAGAGAGG + Intronic
1192855920 X:75011759-75011781 CTGGGGTGGTGGTGACTACAGGG - Intergenic
1193088447 X:77468428-77468450 CTGGGGTGGTGGTGGCTATAAGG + Intergenic
1193665463 X:84310357-84310379 CTGGGGTGGTGGTAGCTACAGGG + Intergenic
1194006752 X:88504229-88504251 CTGGGGTGATGGTGGCCATTGGG + Intergenic
1194398255 X:93412493-93412515 CTGGGGTGGTGGTGGCTATGGGG + Intergenic
1194692875 X:97009191-97009213 CTGGGGTGGTGATGGCCACACGG - Intronic
1194791845 X:98160187-98160209 CTGGGGTGGCGGTGGCTACAAGG + Intergenic
1194831859 X:98632573-98632595 CTGAGGTGATGGTGGCCATGGGG + Intergenic
1195336899 X:103864134-103864156 TTGGTGAGATGGTGACAAAAAGG + Intergenic
1196029521 X:111081088-111081110 CTGGGGAGATGTTGGTCAAAGGG + Intronic
1196561189 X:117150746-117150768 ATGGGGAGATGTTGGCCAAAGGG + Intergenic
1196639286 X:118039464-118039486 CTGGGGTAAGGATGGCCAAAAGG + Intronic
1197099516 X:122636372-122636394 CTGGGATGGTGGTGGCCACAGGG - Intergenic
1197112979 X:122797999-122798021 CTGGGGTGGTGGTGGCTATGTGG + Intergenic
1197190450 X:123641679-123641701 CCAGGGTGATGGAGGCAGAAGGG - Intronic
1197363167 X:125532495-125532517 CTGGTGTGGTGGTGGCTACAAGG - Intergenic
1197661480 X:129178696-129178718 CTGAAGTGATGGTGGCCACAGGG - Intergenic
1197681789 X:129393290-129393312 CTGGGGTGATGTCAGCAAGAGGG + Intergenic
1197858440 X:130944462-130944484 CTGAGCTGTTTGTGGCAAAAAGG + Intergenic
1197987099 X:132278401-132278423 CTGGGGTGATGCTGGCTACAGGG - Intergenic
1198190529 X:134299817-134299839 CTAGGGTGGTGGTGGCTAAGAGG + Intergenic
1198293074 X:135257396-135257418 CAGTGGTGATGGTGGCCACAGGG + Intronic
1198330962 X:135622025-135622047 CTGGGGAGATGATGGCGAAAAGG + Intergenic
1198335963 X:135666970-135666992 CTGGGGAGATGATGGCGAAAAGG - Intergenic
1198818024 X:140614110-140614132 CTGTGGTGATGGTGGCTATGGGG - Intergenic
1200101189 X:153689706-153689728 CTGGGGTGGGGGTGGCAGAAGGG - Intronic