ID: 945188819

View in Genome Browser
Species Human (GRCh38)
Location 2:207166148-207166170
Sequence ACGCCCTCCTCGAGATCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945188819_945188825 14 Left 945188819 2:207166148-207166170 CCGTGGGATCTCGAGGAGGGCGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 945188825 2:207166185-207166207 GTGACCATGTAAGGTAAACAGGG 0: 1
1: 0
2: 1
3: 3
4: 101
945188819_945188822 5 Left 945188819 2:207166148-207166170 CCGTGGGATCTCGAGGAGGGCGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 945188822 2:207166176-207166198 AGGCCGCGTGTGACCATGTAAGG 0: 1
1: 0
2: 0
3: 3
4: 44
945188819_945188826 15 Left 945188819 2:207166148-207166170 CCGTGGGATCTCGAGGAGGGCGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 945188826 2:207166186-207166208 TGACCATGTAAGGTAAACAGGGG 0: 1
1: 0
2: 0
3: 6
4: 128
945188819_945188824 13 Left 945188819 2:207166148-207166170 CCGTGGGATCTCGAGGAGGGCGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 945188824 2:207166184-207166206 TGTGACCATGTAAGGTAAACAGG 0: 1
1: 0
2: 0
3: 3
4: 113
945188819_945188827 16 Left 945188819 2:207166148-207166170 CCGTGGGATCTCGAGGAGGGCGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 945188827 2:207166187-207166209 GACCATGTAAGGTAAACAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945188819 Original CRISPR ACGCCCTCCTCGAGATCCCA CGG (reversed) Intronic
901811458 1:11769036-11769058 CCGCCCTCCAGGAGAGCCCAGGG + Intronic
902907621 1:19570297-19570319 CCGCCCACCTCGGCATCCCAAGG + Intergenic
906152435 1:43595461-43595483 CCGCCCGCCTCGACCTCCCAAGG + Intronic
909730994 1:78889168-78889190 ACTCCCTTCTGGAGATGCCAGGG + Intergenic
912517456 1:110225292-110225314 ACCCCCTTCTCCAGATCCAAGGG + Intronic
1063715564 10:8522937-8522959 TAGCCCTCCTCCAGGTCCCAGGG - Intergenic
1064744070 10:18461861-18461883 ACTCCCTCCTCGAGTGCCAAAGG - Intronic
1065686955 10:28295107-28295129 AAGCCCTCCGTGTGATCCCAAGG + Intronic
1066086473 10:31976733-31976755 CCGCCCACCTCGAACTCCCAAGG - Intergenic
1067903399 10:50265282-50265304 AGGTCCTCGTCTAGATCCCACGG - Intergenic
1072926495 10:99621024-99621046 ACGCCCGCGACGAGATCCCGCGG - Intergenic
1076361236 10:129890335-129890357 AGGCCAGCATCGAGATCCCAGGG + Intronic
1076583496 10:131530473-131530495 ACCCCCTGCTCGAGGTTCCATGG - Intergenic
1079296069 11:19235403-19235425 CCGCCCTCCTCGGCCTCCCAAGG - Intronic
1089081728 11:115781800-115781822 ACGGCCTCTTCCAGCTCCCAAGG - Intergenic
1089532443 11:119139426-119139448 TCGCCCACCTCGATCTCCCAAGG - Intergenic
1090426540 11:126610720-126610742 GAGCCCTCCAAGAGATCCCAGGG - Intronic
1090458593 11:126870252-126870274 ACACCCTCCTCAAGATGCCAGGG + Intronic
1091330052 11:134725180-134725202 AGGCCCTCCTCCAGCTCTCATGG - Intergenic
1104804110 12:131574114-131574136 ACACCCTCCCCAGGATCCCAAGG + Intergenic
1105416871 13:20220922-20220944 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1110890108 13:80688563-80688585 CCACCATCCTCCAGATCCCAGGG - Intergenic
1117352105 14:54891347-54891369 ACGCCCTCCTTGGCCTCCCAAGG + Intronic
1122264240 14:100539290-100539312 ACGCGCTCCTGGAAATCCGAGGG + Exonic
1122442198 14:101739823-101739845 ACTCCCTCCTCTGGATTCCAAGG - Intergenic
1123834329 15:24172486-24172508 CCGCCCTCCTCGGCCTCCCATGG + Intergenic
1129223864 15:74153992-74154014 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1129451933 15:75656078-75656100 ACAACCTCCTCGAGTTCCCTGGG + Intronic
1130042813 15:80419142-80419164 AAGCCCTCCTGGTGATCCCTGGG - Intronic
1132912015 16:2318754-2318776 CCGCCCACCTCGACCTCCCAAGG + Intronic
1136268920 16:29137115-29137137 CCGGCCTCCTCCAGCTCCCAGGG - Intergenic
1142256613 16:89017169-89017191 ACGTCCTCCTAAAGCTCCCACGG + Intergenic
1146851860 17:36228857-36228879 CCGCCCGCCTCGACCTCCCAAGG + Intronic
1146867770 17:36352730-36352752 CCGCCCGCCTCGACCTCCCAAGG + Intronic
1147070644 17:37953347-37953369 CCGCCCGCCTCGACCTCCCAAGG + Intergenic
1147082170 17:38032873-38032895 CCGCCCGCCTCGACCTCCCAAGG + Intronic
1147098117 17:38156838-38156860 CCGCCCGCCTCGACCTCCCAAGG + Intergenic
1148357408 17:46984668-46984690 TCCCCCTCCTCCAGATCTCAAGG + Intronic
1150682367 17:67294014-67294036 CCGCCCACCTCGACCTCCCAAGG - Intergenic
1151549027 17:74810786-74810808 ACGACCTCCTCTAGATGGCATGG + Intronic
1152414011 17:80147316-80147338 CCGCCCTCAACGAGATCCCGCGG - Intergenic
1158796818 18:60856289-60856311 ACTTCCTCCTCCAGTTCCCATGG - Intergenic
1161062218 19:2220930-2220952 CCGCCCACCTCGGCATCCCAAGG - Intronic
1162906482 19:13826907-13826929 CCACCCTCCTCCAGGTCCCATGG - Intronic
1164157286 19:22604335-22604357 ACGCCCCCTCCGAGATCCCCTGG - Intergenic
1165243270 19:34483265-34483287 CCGCCCTCCTCGGCCTCCCAAGG + Intronic
1167207248 19:48110848-48110870 CAGCCCTCCACGTGATCCCACGG - Intergenic
929791078 2:45023557-45023579 ACGCCCTGTTCTAGATCCAAAGG - Intergenic
930869109 2:56151841-56151863 ACTCCCTCCTAGAGTTCCCCAGG - Intergenic
937620960 2:123984540-123984562 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
938388771 2:130887791-130887813 ACGCCGTCCTGGAGACCACATGG - Intronic
945188819 2:207166148-207166170 ACGCCCTCCTCGAGATCCCACGG - Intronic
946061468 2:216945134-216945156 AAGCCCTCCTGAAGATCCCCTGG - Intergenic
946175279 2:217918756-217918778 CCGCCCTCCTCGGACTCCCATGG + Intronic
949050336 2:241894523-241894545 AGGCCGGCCACGAGATCCCAGGG - Intronic
1169059942 20:2653894-2653916 CCGCCCGCCTCGACCTCCCAAGG + Intronic
1169843846 20:9968374-9968396 AGGCCCTGCTGGAGATCCCATGG - Intergenic
1173403950 20:42748812-42748834 ACCCCCTCCTCCACACCCCAGGG + Intronic
1176597203 21:8758473-8758495 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1176643020 21:9324414-9324436 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
1180421244 22:12816362-12816384 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
965830059 3:172775875-172775897 CCGCCCGCCTCGACCTCCCAAGG + Intronic
967185060 3:186937655-186937677 ACTCCCTCCTCAAGGTCGCACGG - Intronic
1202743865 3_GL000221v1_random:80600-80622 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
969417336 4:7069127-7069149 CTGCCCTCCCCGGGATCCCAGGG + Intergenic
969417348 4:7069159-7069181 GTGCCCTCCCCGGGATCCCAGGG + Intergenic
969417361 4:7069191-7069213 ATGCCCTCCCCAGGATCCCAGGG + Intergenic
969517001 4:7653484-7653506 CCGCCCGCCTCGACCTCCCAAGG + Intronic
970429491 4:15975635-15975657 AGACCCTCCTAGAGGTCCCAGGG - Intronic
973360497 4:49160692-49160714 CCGCCCTCCTCGGCCTCCCAAGG - Intergenic
973399587 4:49627221-49627243 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
982813797 4:159860303-159860325 ACTACCTTCTCGAGATTCCAGGG - Intergenic
988210066 5:28192584-28192606 ACTCCCAGCTTGAGATCCCATGG + Intergenic
992266512 5:75023896-75023918 ACGCCCTCCTGGAGCACCCTCGG - Intergenic
998588395 5:143452240-143452262 AAGCCCTCCTTGATTTCCCAAGG + Intergenic
1001109386 5:168883293-168883315 ACGCCTTCCTCGGGATCCCCTGG + Exonic
1001824368 5:174733552-174733574 ACACCCTCCCCGAAATCACAGGG + Intergenic
1002683259 5:180986285-180986307 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1005017955 6:21391771-21391793 ACGCCCTCCAGGTGATTCCAAGG + Intergenic
1005215084 6:23516896-23516918 ATGCCCTCCTTGAGAGACCAGGG + Intergenic
1006536245 6:34701278-34701300 CCGCCCGCCTCGACCTCCCAAGG + Intergenic
1006858979 6:37156969-37156991 CCGCCCGCCTCGACCTCCCAAGG - Intergenic
1007581781 6:42964195-42964217 CCTCCCTCCAGGAGATCCCAGGG - Exonic
1012551097 6:100465222-100465244 CCGCGCTCCTCGAGCTCCCTGGG + Intergenic
1014031453 6:116710000-116710022 CCGCCCGCCTCGACCTCCCAAGG + Intronic
1022417311 7:30189392-30189414 ACTCCTTCCTGGAAATCCCAAGG - Intergenic
1029537068 7:101163237-101163259 TCGTCCTCCTCCCGATCCCAGGG + Exonic
1029539307 7:101173429-101173451 ACGCCCTTCCCGCGCTCCCAGGG + Exonic
1033674021 7:143519955-143519977 GCGGCCCCCTCTAGATCCCATGG + Intergenic
1033795588 7:144841360-144841382 CCGCCCTCCTCGGCCTCCCACGG - Intergenic
1034680578 7:152925053-152925075 CCGCCTTCCTCGAGTTCTCAGGG + Intergenic
1035218961 7:157393555-157393577 TCACCCTCCTCAAGATCACAGGG - Intronic
1035270834 7:157719024-157719046 ACCCCCTCCTGGAGCCCCCAGGG - Intronic
1042955513 8:74246007-74246029 ACAGCCTCCTCGAGTTCCCAGGG - Intronic
1047099823 8:121664682-121664704 CCGCCCTCCTCGGTCTCCCAAGG - Intergenic
1047781207 8:128112709-128112731 AAGCCCTCCTCAAGATCCACAGG + Intergenic
1053261430 9:36668754-36668776 CCGCCCTCCTCGGCCTCCCAAGG + Intronic
1055135272 9:72822103-72822125 ACTTCATCCTCCAGATCCCAGGG - Intronic
1056658502 9:88527783-88527805 ACGCCCACCCTGAGATGCCACGG - Intergenic
1057391909 9:94647488-94647510 ACGCACTCCTCAGGATGCCAGGG + Intergenic
1057787165 9:98095913-98095935 TGGCCCTCCTGGAGATCCTATGG + Intronic
1061792796 9:133067228-133067250 ACCCCCACCTCGAGACCCCATGG - Intronic
1203712497 Un_KI270742v1:110565-110587 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1203556097 Un_KI270743v1:208883-208905 CCGCCCTCCTCGGCCTCCCAAGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189995484 X:46633239-46633261 AGGCCCTCCAAGAGACCCCAAGG - Intronic
1199746482 X:150774948-150774970 CCACCCTGCTTGAGATCCCACGG - Intronic