ID: 945191679

View in Genome Browser
Species Human (GRCh38)
Location 2:207195204-207195226
Sequence GGAGGCAAACAACCACTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945191674_945191679 18 Left 945191674 2:207195163-207195185 CCATGCAAGTAACATAAATGAAT No data
Right 945191679 2:207195204-207195226 GGAGGCAAACAACCACTACCAGG No data
945191673_945191679 24 Left 945191673 2:207195157-207195179 CCAGGACCATGCAAGTAACATAA No data
Right 945191679 2:207195204-207195226 GGAGGCAAACAACCACTACCAGG No data
945191672_945191679 27 Left 945191672 2:207195154-207195176 CCTCCAGGACCATGCAAGTAACA No data
Right 945191679 2:207195204-207195226 GGAGGCAAACAACCACTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945191679 Original CRISPR GGAGGCAAACAACCACTACC AGG Intergenic
No off target data available for this crispr