ID: 945197404

View in Genome Browser
Species Human (GRCh38)
Location 2:207250207-207250229
Sequence CACTTGCAACAAAATTACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945197402_945197404 -9 Left 945197402 2:207250193-207250215 CCTATGCTTGTAAACACTTGCAA No data
Right 945197404 2:207250207-207250229 CACTTGCAACAAAATTACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945197404 Original CRISPR CACTTGCAACAAAATTACAC GGG Intergenic
No off target data available for this crispr