ID: 945200436

View in Genome Browser
Species Human (GRCh38)
Location 2:207275656-207275678
Sequence TGTCTTTGAAGGAGCTACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945200436_945200443 25 Left 945200436 2:207275656-207275678 CCAGCGTAGCTCCTTCAAAGACA No data
Right 945200443 2:207275704-207275726 TTCCTGACCCTCACTTTACACGG No data
945200436_945200444 26 Left 945200436 2:207275656-207275678 CCAGCGTAGCTCCTTCAAAGACA No data
Right 945200444 2:207275705-207275727 TCCTGACCCTCACTTTACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945200436 Original CRISPR TGTCTTTGAAGGAGCTACGC TGG (reversed) Intergenic
No off target data available for this crispr