ID: 945206084

View in Genome Browser
Species Human (GRCh38)
Location 2:207334057-207334079
Sequence GTTCTAATGAGACCAATATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945206077_945206084 10 Left 945206077 2:207334024-207334046 CCCTTATGGATACTTCCAGCTTC No data
Right 945206084 2:207334057-207334079 GTTCTAATGAGACCAATATCAGG No data
945206078_945206084 9 Left 945206078 2:207334025-207334047 CCTTATGGATACTTCCAGCTTCC No data
Right 945206084 2:207334057-207334079 GTTCTAATGAGACCAATATCAGG No data
945206082_945206084 -5 Left 945206082 2:207334039-207334061 CCAGCTTCCAGGGTTCTGGTTCT No data
Right 945206084 2:207334057-207334079 GTTCTAATGAGACCAATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945206084 Original CRISPR GTTCTAATGAGACCAATATC AGG Intergenic
No off target data available for this crispr