ID: 945206687

View in Genome Browser
Species Human (GRCh38)
Location 2:207340440-207340462
Sequence ATTCTATTTTAGGGCCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945206687_945206693 6 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206693 2:207340469-207340491 CAGTTGCCCAATATGGATTCAGG No data
945206687_945206699 14 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206699 2:207340477-207340499 CAATATGGATTCAGGACTGGGGG No data
945206687_945206690 -1 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206690 2:207340462-207340484 TCCATTCCAGTTGCCCAATATGG No data
945206687_945206700 18 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206700 2:207340481-207340503 ATGGATTCAGGACTGGGGGCTGG No data
945206687_945206696 12 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206696 2:207340475-207340497 CCCAATATGGATTCAGGACTGGG No data
945206687_945206694 11 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206694 2:207340474-207340496 GCCCAATATGGATTCAGGACTGG No data
945206687_945206698 13 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206698 2:207340476-207340498 CCAATATGGATTCAGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945206687 Original CRISPR ATTCTATTTTAGGGCCCCAA AGG (reversed) Intergenic
No off target data available for this crispr