ID: 945206688

View in Genome Browser
Species Human (GRCh38)
Location 2:207340449-207340471
Sequence CTGGAATGGATTCTATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945206688_945206698 4 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206698 2:207340476-207340498 CCAATATGGATTCAGGACTGGGG No data
945206688_945206696 3 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206696 2:207340475-207340497 CCCAATATGGATTCAGGACTGGG No data
945206688_945206690 -10 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206690 2:207340462-207340484 TCCATTCCAGTTGCCCAATATGG No data
945206688_945206693 -3 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206693 2:207340469-207340491 CAGTTGCCCAATATGGATTCAGG No data
945206688_945206694 2 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206694 2:207340474-207340496 GCCCAATATGGATTCAGGACTGG No data
945206688_945206700 9 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206700 2:207340481-207340503 ATGGATTCAGGACTGGGGGCTGG No data
945206688_945206699 5 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206699 2:207340477-207340499 CAATATGGATTCAGGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945206688 Original CRISPR CTGGAATGGATTCTATTTTA GGG (reversed) Intergenic
No off target data available for this crispr