ID: 945206690

View in Genome Browser
Species Human (GRCh38)
Location 2:207340462-207340484
Sequence TCCATTCCAGTTGCCCAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945206687_945206690 -1 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206690 2:207340462-207340484 TCCATTCCAGTTGCCCAATATGG No data
945206688_945206690 -10 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206690 2:207340462-207340484 TCCATTCCAGTTGCCCAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945206690 Original CRISPR TCCATTCCAGTTGCCCAATA TGG Intergenic
No off target data available for this crispr