ID: 945206694

View in Genome Browser
Species Human (GRCh38)
Location 2:207340474-207340496
Sequence GCCCAATATGGATTCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945206687_945206694 11 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206694 2:207340474-207340496 GCCCAATATGGATTCAGGACTGG No data
945206689_945206694 1 Left 945206689 2:207340450-207340472 CCTAAAATAGAATCCATTCCAGT No data
Right 945206694 2:207340474-207340496 GCCCAATATGGATTCAGGACTGG No data
945206688_945206694 2 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206694 2:207340474-207340496 GCCCAATATGGATTCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945206694 Original CRISPR GCCCAATATGGATTCAGGAC TGG Intergenic
No off target data available for this crispr