ID: 945206699

View in Genome Browser
Species Human (GRCh38)
Location 2:207340477-207340499
Sequence CAATATGGATTCAGGACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945206688_945206699 5 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206699 2:207340477-207340499 CAATATGGATTCAGGACTGGGGG No data
945206687_945206699 14 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206699 2:207340477-207340499 CAATATGGATTCAGGACTGGGGG No data
945206691_945206699 -9 Left 945206691 2:207340463-207340485 CCATTCCAGTTGCCCAATATGGA No data
Right 945206699 2:207340477-207340499 CAATATGGATTCAGGACTGGGGG No data
945206689_945206699 4 Left 945206689 2:207340450-207340472 CCTAAAATAGAATCCATTCCAGT No data
Right 945206699 2:207340477-207340499 CAATATGGATTCAGGACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945206699 Original CRISPR CAATATGGATTCAGGACTGG GGG Intergenic
No off target data available for this crispr