ID: 945206700

View in Genome Browser
Species Human (GRCh38)
Location 2:207340481-207340503
Sequence ATGGATTCAGGACTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945206692_945206700 -10 Left 945206692 2:207340468-207340490 CCAGTTGCCCAATATGGATTCAG No data
Right 945206700 2:207340481-207340503 ATGGATTCAGGACTGGGGGCTGG No data
945206691_945206700 -5 Left 945206691 2:207340463-207340485 CCATTCCAGTTGCCCAATATGGA No data
Right 945206700 2:207340481-207340503 ATGGATTCAGGACTGGGGGCTGG No data
945206687_945206700 18 Left 945206687 2:207340440-207340462 CCTTTGGGGCCCTAAAATAGAAT No data
Right 945206700 2:207340481-207340503 ATGGATTCAGGACTGGGGGCTGG No data
945206688_945206700 9 Left 945206688 2:207340449-207340471 CCCTAAAATAGAATCCATTCCAG No data
Right 945206700 2:207340481-207340503 ATGGATTCAGGACTGGGGGCTGG No data
945206689_945206700 8 Left 945206689 2:207340450-207340472 CCTAAAATAGAATCCATTCCAGT No data
Right 945206700 2:207340481-207340503 ATGGATTCAGGACTGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945206700 Original CRISPR ATGGATTCAGGACTGGGGGC TGG Intergenic
No off target data available for this crispr