ID: 945216021

View in Genome Browser
Species Human (GRCh38)
Location 2:207434936-207434958
Sequence AGGACTAAGCGACTGGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945216018_945216021 18 Left 945216018 2:207434895-207434917 CCACATTACTGGGCTATAATTTT No data
Right 945216021 2:207434936-207434958 AGGACTAAGCGACTGGCCCAAGG No data
945216017_945216021 24 Left 945216017 2:207434889-207434911 CCAAAACCACATTACTGGGCTAT No data
Right 945216021 2:207434936-207434958 AGGACTAAGCGACTGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945216021 Original CRISPR AGGACTAAGCGACTGGCCCA AGG Intergenic
No off target data available for this crispr