ID: 945221175

View in Genome Browser
Species Human (GRCh38)
Location 2:207485753-207485775
Sequence ATGGACAGTGCCTGGTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945221175_945221180 2 Left 945221175 2:207485753-207485775 CCTCATAACCAGGCACTGTCCAT No data
Right 945221180 2:207485778-207485800 AGCCAACATGAGCAAAGGGTTGG No data
945221175_945221185 19 Left 945221175 2:207485753-207485775 CCTCATAACCAGGCACTGTCCAT No data
Right 945221185 2:207485795-207485817 GGTTGGGGGTCATTGTCCAAAGG No data
945221175_945221178 -3 Left 945221175 2:207485753-207485775 CCTCATAACCAGGCACTGTCCAT No data
Right 945221178 2:207485773-207485795 CATATAGCCAACATGAGCAAAGG No data
945221175_945221184 5 Left 945221175 2:207485753-207485775 CCTCATAACCAGGCACTGTCCAT No data
Right 945221184 2:207485781-207485803 CAACATGAGCAAAGGGTTGGGGG No data
945221175_945221183 4 Left 945221175 2:207485753-207485775 CCTCATAACCAGGCACTGTCCAT No data
Right 945221183 2:207485780-207485802 CCAACATGAGCAAAGGGTTGGGG No data
945221175_945221181 3 Left 945221175 2:207485753-207485775 CCTCATAACCAGGCACTGTCCAT No data
Right 945221181 2:207485779-207485801 GCCAACATGAGCAAAGGGTTGGG No data
945221175_945221179 -2 Left 945221175 2:207485753-207485775 CCTCATAACCAGGCACTGTCCAT No data
Right 945221179 2:207485774-207485796 ATATAGCCAACATGAGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945221175 Original CRISPR ATGGACAGTGCCTGGTTATG AGG (reversed) Intergenic
No off target data available for this crispr