ID: 945221727

View in Genome Browser
Species Human (GRCh38)
Location 2:207490457-207490479
Sequence CATTGTGAAGGGAGTGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945221721_945221727 -10 Left 945221721 2:207490444-207490466 CCCTCTTACTGCACATTGTGAAG No data
Right 945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945221727 Original CRISPR CATTGTGAAGGGAGTGGAGA GGG Intergenic
No off target data available for this crispr