ID: 945222969

View in Genome Browser
Species Human (GRCh38)
Location 2:207503492-207503514
Sequence CCTCCCATGCACACACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945222961_945222969 8 Left 945222961 2:207503461-207503483 CCCCAGCCAAGACTCGATTCTGA No data
Right 945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG No data
945222959_945222969 12 Left 945222959 2:207503457-207503479 CCACCCCCAGCCAAGACTCGATT No data
Right 945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG No data
945222960_945222969 9 Left 945222960 2:207503460-207503482 CCCCCAGCCAAGACTCGATTCTG No data
Right 945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG No data
945222962_945222969 7 Left 945222962 2:207503462-207503484 CCCAGCCAAGACTCGATTCTGAG No data
Right 945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG No data
945222963_945222969 6 Left 945222963 2:207503463-207503485 CCAGCCAAGACTCGATTCTGAGC No data
Right 945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG No data
945222964_945222969 2 Left 945222964 2:207503467-207503489 CCAAGACTCGATTCTGAGCTCCC No data
Right 945222969 2:207503492-207503514 CCTCCCATGCACACACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945222969 Original CRISPR CCTCCCATGCACACACTGCA TGG Intergenic
No off target data available for this crispr