ID: 945225713

View in Genome Browser
Species Human (GRCh38)
Location 2:207529845-207529867
Sequence GAGCGGCCCCGCCCCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945225713_945225717 0 Left 945225713 2:207529845-207529867 CCAGCGCGGGGGCGGGGCCGCTC 0: 1
1: 1
2: 4
3: 31
4: 322
Right 945225717 2:207529868-207529890 GAGCTGCTCCGGGCCTAGCTCGG 0: 1
1: 0
2: 0
3: 16
4: 157
945225713_945225720 16 Left 945225713 2:207529845-207529867 CCAGCGCGGGGGCGGGGCCGCTC 0: 1
1: 1
2: 4
3: 31
4: 322
Right 945225720 2:207529884-207529906 AGCTCGGCTGTTTCCGTGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 38
945225713_945225715 -10 Left 945225713 2:207529845-207529867 CCAGCGCGGGGGCGGGGCCGCTC 0: 1
1: 1
2: 4
3: 31
4: 322
Right 945225715 2:207529858-207529880 GGGGCCGCTCGAGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945225713 Original CRISPR GAGCGGCCCCGCCCCCGCGC TGG (reversed) Intronic
901045515 1:6393481-6393503 CGCCGACCCCGCCCCCGCGCCGG + Intronic
901525973 1:9823706-9823728 GCGCCGCCCCGCTCCCGCGCTGG - Exonic
901637821 1:10678479-10678501 GGGCAGCACCGCCCCCGCGAGGG + Intronic
903350044 1:22711580-22711602 GAGCGCGCCAGCCCCCGCGTCGG + Intronic
903862879 1:26375619-26375641 GAGCGGCCCTTCCTCCGGGCTGG + Intergenic
903883739 1:26529698-26529720 CTCCGGCTCCGCCCCCGCGCAGG + Intergenic
905037951 1:34929706-34929728 CCCCGCCCCCGCCCCCGCGCAGG + Intergenic
905066865 1:35192145-35192167 CCTCGCCCCCGCCCCCGCGCTGG - Intronic
905126456 1:35718961-35718983 GAACCGCTTCGCCCCCGCGCGGG + Exonic
906069635 1:43007573-43007595 GGGCAGCCCCGCCCCGCCGCCGG + Intergenic
906214320 1:44030358-44030380 CCACGGCCCCGCCCCCGGGCCGG + Intronic
908128186 1:61050658-61050680 GAGCCGCCGCGGCCCCGCCCGGG + Intronic
910384540 1:86666464-86666486 GAGCTCCCCCAGCCCCGCGCAGG - Intergenic
912798618 1:112707220-112707242 GGCCCGCCCCGGCCCCGCGCAGG + Intronic
912800187 1:112715326-112715348 CCGCGGCCCCGCCCCCGCCCAGG + Exonic
914243892 1:145872110-145872132 GAGCGGCCAGGTCCCCGCTCCGG + Exonic
914702944 1:150150380-150150402 GCCCGGCCGCGCCCCCGCCCCGG + Intronic
914869058 1:151458625-151458647 GCACGGCCTCGCCCCCTCGCCGG + Intronic
915586902 1:156848879-156848901 GTCCGGTCCCGCCCCCGCTCCGG + Intronic
916496728 1:165354265-165354287 GACCGGCCCAGCTCCCGAGCCGG - Intronic
918332405 1:183472539-183472561 GAGCGGCCCCGCGGCACCGCGGG - Exonic
920674607 1:208030403-208030425 GAGCATCCCCGGCCCAGCGCTGG - Intronic
921599287 1:217089724-217089746 GGCCGGCCCCGCGCCCGCGGGGG - Intronic
922322914 1:224503593-224503615 GAGGGGACCCGCCCCTGTGCAGG - Intronic
1063449949 10:6144740-6144762 GGGCGGCCCGGCCCACGCCCCGG + Intergenic
1065100367 10:22325575-22325597 CACCCACCCCGCCCCCGCGCCGG + Intronic
1065687661 10:28302643-28302665 AGGCGGCCCCGCCCCTGCCCCGG + Intronic
1065883633 10:30058910-30058932 CCGCGGCCCCGCTCCCGCTCCGG - Intronic
1069761812 10:70816247-70816269 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1069952036 10:72025656-72025678 GATCCACCCCACCCCCGCGCAGG - Intergenic
1070623711 10:78033785-78033807 GCGCGCCCACGCCCCCACGCCGG + Exonic
1072421106 10:95291067-95291089 GGGCGGAGCCGCCCCCGCCCTGG - Intergenic
1073094188 10:100969807-100969829 ACGCGGCCCCCTCCCCGCGCTGG - Intronic
1073207424 10:101776285-101776307 CGGCCGCCCCGCCCCCGCCCCGG - Intronic
1074056057 10:109923586-109923608 CCGCGGCCCCGCCCACACGCAGG + Intergenic
1074591858 10:114821684-114821706 TAGCGGCCCCGCCGCAGGGCAGG + Intergenic
1077102085 11:826970-826992 GAGGGGCCCCTCCCAGGCGCTGG + Intronic
1077121509 11:910955-910977 GCGCGGCCCCGCCCCGGCCCCGG - Intronic
1077192199 11:1260230-1260252 GGGAGGCCCCGCCCCTGCCCGGG + Intronic
1077250063 11:1557011-1557033 CGGCGGCCCCGGCCCCCCGCCGG - Exonic
1077891266 11:6419427-6419449 GTGCGGCGCCGCGGCCGCGCGGG + Intergenic
1079251680 11:18791841-18791863 GCTCCGCCCCGCCCCCGGGCGGG + Exonic
1079708653 11:23653276-23653298 GAGCCTCCCCGCCCCCGCCATGG - Intergenic
1081807869 11:45900080-45900102 AAGCGGCCTCGGCCCCGCCCCGG + Intronic
1083335118 11:61917599-61917621 GCCCGGCCCCGCCCCTCCGCCGG + Intronic
1083430802 11:62612793-62612815 AAGCGGCCCGGCCCCCCCTCGGG - Exonic
1083607349 11:63986759-63986781 GAGCGACCCAGGCCCCGCCCCGG - Intronic
1083662695 11:64259124-64259146 AAGCGGCACCGACCCAGCGCAGG + Exonic
1083667712 11:64284790-64284812 GCCCGGCCCCGCCCCCCCGCCGG + Intronic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1083927601 11:65818023-65818045 GAGGCGCCCCGACACCGCGCCGG + Intergenic
1084207941 11:67606827-67606849 CAGCGGCCCCGCCTCCTCGGGGG - Intergenic
1084385205 11:68839414-68839436 CAGCAGCCCCGCCCCCAGGCTGG + Intronic
1084431885 11:69115819-69115841 GAGCGGCCCCGCCCTCCCCCAGG - Intergenic
1084787684 11:71453030-71453052 GAAGGGCCCCGCCCCCGCCCCGG - Intergenic
1085396874 11:76210839-76210861 GGGTGGCCCCGGCCGCGCGCGGG + Intergenic
1087113200 11:94493942-94493964 GCGAGGCCCCGCCCTCACGCAGG + Exonic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1089482780 11:118820620-118820642 GCTCGGCCCCTCCCCCGCCCTGG - Intergenic
1089842123 11:121427379-121427401 GAGCTGCGCAGCCGCCGCGCCGG + Intergenic
1090029764 11:123196257-123196279 GAGCAGCCCCGCCCCAGGGTCGG + Intergenic
1090788384 11:130069661-130069683 GGATGGCCCCGCCCCCGCTCCGG - Intergenic
1091273103 11:134331849-134331871 CAGAGGCCCCGCCCCGGCCCCGG + Intergenic
1091595867 12:1878840-1878862 GAGGGGCCCCACCCCAGCTCTGG + Intronic
1091825590 12:3510201-3510223 GAGCCGCCCCACCCCAGAGCAGG - Intronic
1093464846 12:19439376-19439398 GCCCGCCCCCGCCCCCGCCCCGG - Intronic
1095976067 12:47941961-47941983 CAGAGGCCCAGCCCCCGCTCGGG + Intronic
1095986260 12:48001628-48001650 GCCTGGCCCCGCCCCTGCGCCGG - Intronic
1096116947 12:49060391-49060413 GAGCTGCCCCGCCCCCGGCCTGG + Intergenic
1096191626 12:49623602-49623624 GAGCCCCTCCACCCCCGCGCGGG - Intronic
1096598638 12:52714245-52714267 GAGCTCCCCCGCACCCCCGCGGG - Intergenic
1096634353 12:52949060-52949082 GTGAGGCCCCGCCCCCGCCCCGG - Exonic
1097194256 12:57235127-57235149 GAGCAGCGCCGCCCCTGGGCTGG + Exonic
1097925433 12:65121608-65121630 TCGCGGCCCCGCCCCCGGGGGGG - Intergenic
1098161311 12:67649546-67649568 GCGCGGCCCGGCTCCCCCGCCGG + Intronic
1102025925 12:109714338-109714360 CAGCGGCCCCGGCTCCTCGCCGG - Exonic
1103309022 12:119989689-119989711 GGCCCGCCCCTCCCCCGCGCCGG - Intergenic
1103364069 12:120369462-120369484 CCGCGGCCGGGCCCCCGCGCCGG - Intergenic
1105074529 12:133264223-133264245 GAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1105472188 13:20704074-20704096 GCGCAGCCCCGCGGCCGCGCGGG - Exonic
1107603984 13:42040680-42040702 GCGCTCTCCCGCCCCCGCGCCGG - Intronic
1112012055 13:95301062-95301084 GGGTGGCGCCGCCCCCACGCCGG - Intronic
1112652759 13:101416509-101416531 GAGCGCCGCCGCCGCCGGGCAGG + Intergenic
1113535857 13:111065892-111065914 ACGCGGCCCCGCCCAAGCGCTGG + Intergenic
1114265351 14:21070168-21070190 GCCCGCCCCCGCCTCCGCGCGGG - Intronic
1117547968 14:56808761-56808783 GAGCGGCGCCGACCCTGCGGTGG - Intronic
1118220975 14:63853775-63853797 GCGCCCCCCCGCCCCCGCGGAGG - Intronic
1118514164 14:66508345-66508367 GCGCGGCCTCTCCCCCACGCAGG + Exonic
1119709722 14:76812884-76812906 GCTCGGCCCCGCCCCCGGCCCGG + Exonic
1121101573 14:91253581-91253603 GAGCGGCCCCGCGAGCGCGGGGG - Intronic
1121168829 14:91836332-91836354 GCGCGGCGCCGGCCCAGCGCGGG - Intronic
1121410251 14:93744459-93744481 GAGCAGCCCCGCACCCAGGCTGG - Intronic
1121473465 14:94174291-94174313 GGCCCGCCCCGCCCCCTCGCCGG + Exonic
1121617039 14:95320053-95320075 CAGGGCCCCCGCCCCCGCACGGG - Intergenic
1121645751 14:95516424-95516446 CGGGGCCCCCGCCCCCGCGCCGG + Intronic
1122220885 14:100238702-100238724 CCGCGGCCCCGCCCACTCGCCGG - Intronic
1122688539 14:103521173-103521195 GAGGGGCCCCACCCCCGCGAGGG + Intronic
1124109326 15:26772506-26772528 GAGCCGCCCGCGCCCCGCGCCGG - Intronic
1124109467 15:26772977-26772999 GGGCGCCCCCTCCCCCGTGCCGG - Exonic
1125004211 15:34799581-34799603 GAGCGGCCCAGCCTCCTCCCCGG + Intergenic
1125731346 15:41894239-41894261 GAGCGGCCCTGCCACCGCATGGG + Intergenic
1127415165 15:58750036-58750058 GAGCGCTCCCGCCCCGGGGCGGG - Intergenic
1128016972 15:64356175-64356197 GCGCGGCCCCGCCCTCGTCCCGG + Exonic
1128056506 15:64703341-64703363 GCACCGCCCCGCCTCCGCGCAGG + Intergenic
1128456029 15:67831922-67831944 GACAGACCCCGCCCCCGCCCCGG - Intronic
1129299190 15:74615744-74615766 GAGCGGCCAGGCCTCCGAGCCGG + Exonic
1129468743 15:75738633-75738655 GAGCGGCCCCGCCCACCCTAAGG + Intergenic
1129483027 15:75843129-75843151 GCGCGCCCCCGCCCCCGGCCTGG - Intergenic
1130352877 15:83107353-83107375 GGGCGGCGACACCCCCGCGCAGG - Intergenic
1132273208 15:100544502-100544524 GAGGGTCCTCGTCCCCGCGCAGG - Intronic
1132398025 15:101488938-101488960 GAGGGGCCGCTCCCCCGCGGGGG + Intronic
1132543971 16:524667-524689 GAGCGGCTCTGCCCCTGCCCTGG + Intergenic
1132639408 16:970868-970890 GCGGGGCCACGCCCCGGCGCGGG + Exonic
1132639497 16:971139-971161 AGCCGGCCCCGCCCACGCGCGGG + Intronic
1132640777 16:977381-977403 GAAAGGCCCCGCCCCCGGACGGG - Intronic
1132724698 16:1333721-1333743 GAGCCCCCCCATCCCCGCGCCGG + Intronic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1132887576 16:2189390-2189412 CCGCTGCCCCGCCCCCGCTCGGG + Intronic
1132933769 16:2471234-2471256 GAGCAGCCCCGCCCCCGGCTGGG + Intergenic
1133053877 16:3135123-3135145 CAGAGGCCCCGTCCCCGCCCCGG - Exonic
1133170090 16:3977514-3977536 CAGCGGCCCGGCCCCCACGACGG + Exonic
1133232094 16:4371776-4371798 GAGAGGCCCCGCCCCTGCCGCGG + Intronic
1133304852 16:4802478-4802500 GCCCGGCCCCGCCGCCCCGCCGG + Intronic
1133464859 16:6019505-6019527 GAGCGCCCCCGCCCCACCGCGGG - Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134441550 16:14302173-14302195 GGCCGGCCCAGCCCCCGCCCCGG + Intergenic
1134849794 16:17470602-17470624 CCCCGGCCCCGGCCCCGCGCCGG - Exonic
1135335806 16:21599918-21599940 GGGCCGCCACGCCCCCGCCCCGG - Intronic
1136390602 16:29962007-29962029 GCGCGGCCCCGCCCCGCGGCCGG - Intronic
1137655159 16:50153219-50153241 CAGAGGCCCCGCCCCGGGGCCGG + Intronic
1137988846 16:53131639-53131661 GGGAGGCCCCGACCTCGCGCGGG - Intronic
1138249821 16:55493183-55493205 CACCGGCCCCACCCCCACGCTGG + Exonic
1139469367 16:67170112-67170134 CAGCGGCCCCGCGCCAGCCCTGG - Intergenic
1139576769 16:67847007-67847029 CTGCGGCCCAGCCCCCGCCCCGG - Intronic
1141442323 16:84037374-84037396 GGGCGGCACCGCCCCCTTGCAGG + Intronic
1141709409 16:85689156-85689178 GACAGGCCCCGCCCCCACCCCGG + Intronic
1142136151 16:88452945-88452967 GTTCGGCCCCGCCCGCGCCCCGG - Intergenic
1142381337 16:89733954-89733976 GAGCGGCCCTGCCCCCACCCTGG + Exonic
1143183543 17:4998039-4998061 GAGCTGCCCCCGCCCCTCGCCGG - Exonic
1143492763 17:7293962-7293984 GTCCGGCCACGCCCCCGGGCGGG - Intronic
1143904569 17:10198597-10198619 GAGCGGCGACGCCCCCGGGCCGG + Intergenic
1144574163 17:16418451-16418473 GGCAGGCCCCGCCCCCGGGCAGG - Intronic
1144787474 17:17840109-17840131 GGGCGGCTCCGCACGCGCGCGGG + Intergenic
1145214716 17:21042892-21042914 GAGCAGCCCCCACGCCGCGCTGG - Exonic
1146398717 17:32487506-32487528 GAGCGCCCCCGCCTCCTCTCCGG + Exonic
1146581145 17:34039971-34039993 GAGAGGCCCCGGCTCCGCCCCGG - Intronic
1148081066 17:44967934-44967956 GTGCGACCCCTACCCCGCGCGGG - Exonic
1148549745 17:48543421-48543443 GGGCGGCCCCTCCGCCTCGCGGG - Exonic
1149994564 17:61399935-61399957 GAGCTGGCCCGCTCCGGCGCCGG - Exonic
1149995605 17:61404690-61404712 GTGCGACCCTCCCCCCGCGCGGG + Exonic
1150108620 17:62479175-62479197 GAGAGGCCCCGGCTCCGCCCCGG + Exonic
1150217211 17:63477357-63477379 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG + Intergenic
1152318444 17:79594531-79594553 GTGCAGCCCGGCCCCTGCGCAGG + Intergenic
1152321468 17:79610617-79610639 CAGGGACCCCGACCCCGCGCAGG + Intergenic
1152549699 17:81022955-81022977 TAGTGGCCCCTCCCCCGCCCTGG - Intergenic
1152613756 17:81328687-81328709 GCGAGGCCCCGCCCCCACCCTGG - Intronic
1152648579 17:81481654-81481676 GAGCGCCCCCGCCCCGGAGCAGG + Intergenic
1152654403 17:81513156-81513178 GCGCGGCCCCGCCCCGGGTCAGG - Intronic
1152799322 17:82323593-82323615 GAGCGGCCACCCCACCGTGCGGG - Intronic
1152834321 17:82519701-82519723 GCGCGGCCGCGCCACCGAGCCGG - Exonic
1154218544 18:12433094-12433116 AAGCGGCGCCGCACCCGTGCTGG + Intergenic
1156250152 18:35344526-35344548 GGGCCGCCCCTCCCCCGCCCGGG - Intronic
1158505740 18:58044627-58044649 GAGCGCCTCAGACCCCGCGCGGG + Exonic
1158601950 18:58863525-58863547 GAGCGGCCTCGCCGCCGGGCCGG - Intronic
1159008590 18:63037199-63037221 GGGCCACCCCGCCCCCGCCCCGG + Intergenic
1160019273 18:75167785-75167807 GAGCCGCCTCGCCCCCACCCTGG - Intergenic
1160537445 18:79602702-79602724 GAGAGACCCCGCCCCTGCCCTGG + Intergenic
1160824024 19:1071173-1071195 AGGAGGCCCCGCCCCCGCGAGGG - Intronic
1160866971 19:1260407-1260429 GGGCGCCACCGCCCCCTCGCTGG + Intronic
1161233235 19:3186008-3186030 GCGCGGCCCCGCCGCCGGCCAGG + Exonic
1161301042 19:3543476-3543498 GAGTGCCCCCCCCCCCGCCCTGG + Intronic
1161439703 19:4283860-4283882 GAGCCACCGCGCCCCCGCCCGGG + Intronic
1161510944 19:4670528-4670550 CGGCGGCCCCGCCCCCTCGGCGG - Intergenic
1161865388 19:6829003-6829025 GCCCGGCCCCGCCCCTGCCCAGG - Intronic
1161981459 19:7632494-7632516 GAGCGACCCCACCCCCGAGATGG - Exonic
1162024922 19:7888457-7888479 GAGCCGCCCCGCCCCGCCCCCGG - Intergenic
1162339868 19:10086065-10086087 ATGCGGCCCCGCCCCCACGAGGG + Intergenic
1162341916 19:10096410-10096432 GAGCGGCCCCGCATCCACGCGGG - Exonic
1162535871 19:11262529-11262551 GAAGGGCCCCGCCCCCGCGCCGG - Intergenic
1162576974 19:11505138-11505160 GGGCAGCCCCGCCCCCTCACCGG - Intronic
1162739506 19:12766014-12766036 AAGCGGCCCCCCACCCTCGCAGG - Exonic
1162901014 19:13795611-13795633 AAGAGGCCCCGCCCCGGCCCTGG + Exonic
1162940391 19:14005897-14005919 CCGCGGCCCGGCCCCCGCGAGGG - Intronic
1163158021 19:15449643-15449665 GCACGGCCCCGCCCCCGGCCAGG + Intronic
1163607205 19:18281826-18281848 GGGCGGCCGCGCGCCCGGGCCGG + Intergenic
1163666669 19:18606841-18606863 GCCCGGCCCCGCCCCCGGCCCGG + Exonic
1163793372 19:19321205-19321227 GAGCGGCCCCCCACCCGCCGCGG - Intronic
1164469802 19:28520444-28520466 GAGCGGCCCGGCTCCCTGGCCGG - Intergenic
1164624062 19:29715090-29715112 GAGGCGCCCCGCCCCGGCTCCGG + Intronic
1165167722 19:33868950-33868972 GAGCGGCACCGCTCCCGGGCAGG - Intergenic
1165213668 19:34254524-34254546 GTCCGGCCCCGCCCCCGCCTCGG - Exonic
1165242892 19:34481822-34481844 GAACGACCCCGGCCCGGCGCCGG + Exonic
1165825532 19:38703675-38703697 GAGCAGCCCCGCCCTCACGAGGG + Intronic
1167251423 19:48400244-48400266 GAGAGGCCCCGCCCCTTCTCAGG - Intronic
1167643976 19:50695871-50695893 GTGCCGCCCCCTCCCCGCGCTGG - Intronic
1168251913 19:55146513-55146535 GAGCGGCCACGCCCGGGCGCGGG + Intronic
1168272622 19:55258434-55258456 GAGCCGCCGCCCCCCCTCGCAGG - Exonic
1168315152 19:55481868-55481890 GCACGGCGCCGCCCCCGCCCCGG + Exonic
1168705220 19:58466952-58466974 TAGTGGCCCCGCCTCCACGCAGG + Intergenic
924958322 2:10870-10892 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958327 2:10899-10921 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958332 2:10928-10950 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958337 2:10957-10979 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958342 2:10986-11008 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958347 2:11015-11037 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958352 2:11044-11066 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958357 2:11073-11095 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958362 2:11102-11124 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
924958367 2:11131-11153 GAGGCGCACCGCGCCCGCGCAGG + Intergenic
926095694 2:10079828-10079850 GCGCGTCCCCGCCCCAGCCCTGG - Intronic
926185925 2:10690524-10690546 GAACTGCCTCGCCCCCGCCCGGG - Intergenic
926422931 2:12716832-12716854 GCCCCGCCCCGCCCCCGCCCGGG - Intergenic
926801845 2:16665930-16665952 CAGCCGCCCCGCCCCGGCCCCGG + Intronic
927474224 2:23400249-23400271 GAGCGGCCCCTGCCCCAGGCAGG + Intronic
928303622 2:30147636-30147658 AAGCGGCCCAGCCACCGGGCTGG + Intronic
931622826 2:64228380-64228402 GCGTGGCCCCGCCAGCGCGCAGG + Intergenic
932591463 2:73070625-73070647 GAGCGGCCCCTCCCCGGCTCCGG + Intronic
940009496 2:149038862-149038884 GCGCGGCCCCGCACTCGCTCCGG - Intronic
940639641 2:156333033-156333055 GAGCGGCCGAGCCGCTGCGCGGG - Intronic
940918890 2:159286556-159286578 GAGCGGCCGCGCCCACGGGCCGG - Exonic
941367041 2:164621614-164621636 GAGCGCCCCGGGCCACGCGCGGG - Exonic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
946235670 2:218323193-218323215 GCCCGGCCCCGGCCCCCCGCGGG - Intronic
947119177 2:226798882-226798904 CAGCTGCCCCTCCCCGGCGCGGG - Exonic
948274044 2:236694790-236694812 GAGGGGCCCAGCCCCCACCCAGG - Intergenic
948738321 2:240025422-240025444 GCGCGGCCCCGCCCCCTGGAAGG - Intergenic
948922002 2:241070217-241070239 CACTGGCCCCGCCCACGCGCAGG - Intronic
948933804 2:241149649-241149671 GGGCGCCTCCGCCCCCGGGCCGG + Intronic
948988717 2:241541264-241541286 GACAGGCCCCGCCCCCGCCGCGG - Intergenic
1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG + Exonic
1172026419 20:31951850-31951872 GAGAGGCCCCTCCGCGGCGCTGG - Intronic
1174178286 20:48658487-48658509 GAGCGGTCCCACCCCAGGGCAGG + Intronic
1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG + Intronic
1175859577 20:62143171-62143193 CCGCGTCCCCGGCCCCGCGCAGG + Intronic
1176213711 20:63938648-63938670 AGCCGGCCCCGCCCCCGCGCTGG - Intergenic
1178513825 21:33229891-33229913 CTCCGCCCCCGCCCCCGCGCCGG + Intronic
1178561541 21:33643015-33643037 CCGCGGCCCCGCCGCCGAGCGGG + Intronic
1178914580 21:36699385-36699407 CAGCGCCTCCGCCTCCGCGCCGG + Exonic
1180682665 22:17639095-17639117 GCGCGGCCCCGCCGCTGAGCAGG + Intronic
1181514366 22:23402672-23402694 GCCCGGGCCCGCGCCCGCGCCGG - Intergenic
1181567904 22:23750980-23751002 GAGCTGCCCCGCCCCGGCCCAGG - Exonic
1181567914 22:23751004-23751026 CTGCGGCCCCGCCCCGGCCCAGG - Exonic
1181956359 22:26590135-26590157 CCGCGGCCCCGCCCCCGCGCGGG - Exonic
1182295000 22:29307264-29307286 GGGCGGCCCCGCACCCTCTCTGG + Intronic
1183201395 22:36387685-36387707 GTGCGGCCCGCCACCCGCGCGGG - Intronic
1183788433 22:40045300-40045322 GGGCGCCCCGGCCCGCGCGCCGG - Intronic
1184562054 22:45269129-45269151 GCGCGGCACCGCCCCCTCCCCGG + Intergenic
1184999678 22:48237753-48237775 CAGCGCCCCCTCCCCAGCGCAGG + Intergenic
1185278643 22:49960702-49960724 GATTCGCCCCGCCCCCGCGGAGG + Exonic
1185333482 22:50261720-50261742 GCACGGCCCCTCCCCCGCCCGGG + Exonic
1185413495 22:50697749-50697771 GCGCCGCCCCCTCCCCGCGCCGG - Intergenic
950345325 3:12287853-12287875 GCCCGCGCCCGCCCCCGCGCCGG + Intronic
950610662 3:14124782-14124804 GCGCGGACCCGCCCCCTCCCAGG + Exonic
954249827 3:49358784-49358806 AAGCGGCACCGCCCTCGTGCGGG + Intergenic
959375132 3:105580494-105580516 AAGCTGCCCCGCCCCTGCACTGG - Intergenic
960747668 3:120908146-120908168 GGCAGGCCCCGCCCCCGGGCCGG - Exonic
961081525 3:124032934-124032956 CGGCGGCCCCGCCCCCTCCCTGG + Intergenic
961551555 3:127672866-127672888 CCGCGGCCCCGCCCCTGCCCCGG - Intergenic
964438086 3:156674873-156674895 CCCCGGCCCCGGCCCCGCGCCGG + Exonic
967849502 3:194071218-194071240 CAGCTGCCCCGCGCCCGCCCGGG - Intergenic
968008870 3:195260254-195260276 GCGCGGTCCCTCCCCCGCCCGGG - Intronic
968742328 4:2337528-2337550 GAGGGGCCCCGCCACAGCCCAGG - Intronic
968965265 4:3766291-3766313 GCGCGGCCCCGCCCTCGGCCCGG - Intergenic
970188260 4:13484709-13484731 GACAGGCCCCGCCCCGCCGCCGG - Intergenic
970394714 4:15654888-15654910 GGCCGGCCCCACCGCCGCGCTGG - Intronic
972437038 4:39044753-39044775 GCCAGGCCCCGCCCCCTCGCCGG - Intergenic
977206555 4:94170117-94170139 GAGCCTCCCCACCCCCGCCCTGG + Intergenic
978532586 4:109729999-109730021 GAGCGGGCGCGTCCCCGCGACGG - Exonic
982712244 4:158769105-158769127 GGGCGGCCGCGCCGCCGCGATGG + Intergenic
982745794 4:159103351-159103373 GAGCGGAGCTGCCCCGGCGCCGG - Intergenic
983533416 4:168833065-168833087 GGCCGGCCCCGCCCCGGGGCTGG + Intronic
984823625 4:183905820-183905842 GAGCAGCGCTGCCGCCGCGCGGG + Exonic
985784571 5:1887061-1887083 GAGCGGCCCAGCGCCACCGCAGG - Exonic
986152507 5:5140340-5140362 CAGCGACTCCGCCGCCGCGCCGG - Exonic
987132476 5:14872041-14872063 CAGCGCCGCCGCCCCCGGGCCGG - Intergenic
992597315 5:78360059-78360081 CAGCGGCCGCGCCCCCGCCCCGG + Intergenic
997470664 5:134115245-134115267 GAGCGTCCCTGCCCCGGCGTCGG + Intronic
998176275 5:139904062-139904084 GGGCGGCCGCGTCCCCACGCAGG - Intronic
999300202 5:150486154-150486176 GAGCTGCCCCGGCGCAGCGCCGG + Intronic
1002064905 5:176647207-176647229 GCCAGGCCCCGCCCCCGCGCAGG - Intergenic
1002559576 5:180072136-180072158 CCGCCGCCCCGCCCCCCCGCTGG + Intergenic
1003552124 6:7108837-7108859 GGGCAGCCCCGCGCCCTCGCGGG + Intronic
1004442043 6:15662982-15663004 TACCGGCCCCGCCCCCGGTCTGG + Exonic
1006320141 6:33315191-33315213 GTACGGCCCCGACCCCGCCCAGG + Exonic
1006337470 6:33428065-33428087 GAGGGGCCCCGCCCCTGCGCGGG - Intronic
1006458293 6:34144269-34144291 TCCCGGCCCCGCCCCCGCGCGGG + Intronic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1007363213 6:41373195-41373217 GTCCGCCCCAGCCCCCGCGCCGG + Intergenic
1007406376 6:41638335-41638357 GCGGGTCCCCTCCCCCGCGCCGG - Intronic
1007423697 6:41734408-41734430 GCTCGGCCCCCTCCCCGCGCGGG - Intronic
1007625377 6:43243612-43243634 GAGCCGCCCCCGCCCCGCCCCGG + Intergenic
1012399508 6:98832647-98832669 GAGTGGCCCCGCGCTTGCGCTGG + Intergenic
1012410148 6:98947727-98947749 GCTCGGCCCCGGCCCCGCCCCGG + Intronic
1017163878 6:151390635-151390657 GCGCGCCCCCGCCCGCGAGCGGG + Intronic
1018091515 6:160349574-160349596 GATCGCCCCCGCCCACCCGCCGG - Intronic
1019421945 7:954682-954704 GTGCGCCCCGGGCCCCGCGCCGG - Intronic
1019437064 7:1027920-1027942 GAGCGGCCCCGCAACCGGCCAGG - Intronic
1022089289 7:27097025-27097047 GCACCGCCCGGCCCCCGCGCTGG - Intergenic
1022427692 7:30284645-30284667 GAGGTTCCCCGGCCCCGCGCCGG - Exonic
1024537429 7:50449977-50449999 AAGCGGCCCCGCCCCCGGACAGG + Intronic
1026898483 7:74024046-74024068 GAGTGGCCCTGCCCTCGTGCTGG - Intergenic
1027001770 7:74658612-74658634 GCGCGGCCCCGCCCCCGCGCCGG - Intronic
1032082984 7:128869391-128869413 GCTCGGCCCCTGCCCCGCGCAGG + Intronic
1033477131 7:141702033-141702055 GGGCGCCCCCGCCGCCGCCCCGG + Exonic
1034159650 7:148983368-148983390 GCCCGGCCCCACCCCCGCGGCGG + Intergenic
1035022757 7:155808879-155808901 GGACGCCCCCGCCCCCGCGCTGG - Intronic
1035311279 7:157970630-157970652 GAGCGGACCCCCCCCCCCACAGG + Intronic
1036390296 8:8318864-8318886 GCCCGCCCCCGCCCCCGCCCCGG - Exonic
1037803849 8:22048977-22048999 GGGCGGCCCCTCCCTGGCGCGGG + Intronic
1037819910 8:22130582-22130604 GAGCGCCCCCGCCGCCCCGGGGG - Exonic
1037879545 8:22566117-22566139 GGGCGGCCCCGCCACGGCCCAGG + Intronic
1037903836 8:22703782-22703804 GAGCGGCGCCGCCCGCGGCCCGG - Intergenic
1038540171 8:28385392-28385414 GTGCAGCCCCGCCCCCCCCCCGG + Intronic
1038644007 8:29348754-29348776 GAGCCGCTCCTCCCCCCCGCAGG - Intronic
1041096134 8:54351978-54352000 AAGCAGCCCCGCCACCGCGAGGG + Intergenic
1041690016 8:60679150-60679172 GCGCGGCCCCGGCCCCGGCCCGG - Intronic
1041690407 8:60680434-60680456 CAGCGCCCCCACCCCCGCCCGGG - Intronic
1042267687 8:66925599-66925621 ACGCGGCCCCGCCCCTCCGCGGG + Intergenic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1045510800 8:102810722-102810744 CAGCCGCGCCGACCCCGCGCTGG + Intergenic
1045516176 8:102863269-102863291 GAGCGGGGCGGGCCCCGCGCCGG - Intronic
1047615431 8:126558568-126558590 GCCCGGCCACGCCCCCGCGCCGG + Intergenic
1048345225 8:133570827-133570849 GGGTGGCCCTGCCCCCACGCAGG + Intronic
1049100998 8:140578812-140578834 AGGCGGCCCCGGCCCCGTGCGGG - Intronic
1049396347 8:142402945-142402967 GCGCGGCCCCGCCCCCCGCCCGG + Intronic
1049803024 8:144526976-144526998 GAGCGGCTCCCCCGCCGTGCAGG + Exonic
1049867885 8:144950656-144950678 GCGCGGCTCCGCCCCCGCCCGGG + Intronic
1051170652 9:14315599-14315621 GAGCCGCTCGGCGCCCGCGCCGG + Intronic
1051235373 9:14993375-14993397 CTGCGGCCCCGCCCCCGCGCCGG - Intergenic
1053163529 9:35829422-35829444 GTCCGGCCCCGCCCCCGCCCCGG + Intronic
1053489680 9:38489161-38489183 GAGCGGCCCTGCACCCCCTCTGG - Intergenic
1054835665 9:69672604-69672626 CAGCGCCCCTGCCCCGGCGCCGG + Intergenic
1056821147 9:89842971-89842993 GAGCTGCCCCCCACCCCCGCGGG + Intergenic
1057207829 9:93184161-93184183 GCGCGGCTCCGCTCCCGCACCGG - Intergenic
1057259681 9:93576694-93576716 GCGCGGCCCGGCCCCCGGCCCGG + Exonic
1057752416 9:97803500-97803522 CGGTTGCCCCGCCCCCGCGCTGG - Intergenic
1057810849 9:98255637-98255659 CGTCGGCCCCGCCCCCGCCCAGG - Intronic
1060283429 9:122228656-122228678 GGGCGGCCCCGCCACCGACCAGG - Exonic
1060700722 9:125747305-125747327 GGGCCGCCCCCTCCCCGCGCGGG + Intergenic
1061123182 9:128656697-128656719 GAGTGGCCCCGGCTGCGCGCGGG + Exonic
1061151283 9:128829654-128829676 GCGCGGCCCGGCCCCGGCGAAGG + Intronic
1061289395 9:129642114-129642136 GAGCGGACCCGGCCGGGCGCAGG - Exonic
1061453513 9:130681668-130681690 GAGCGCGCCCGCGCCCCCGCCGG + Exonic
1061725595 9:132580487-132580509 AAGCGGCCCCGCCGCCGGCCGGG - Intergenic
1062272178 9:135714582-135714604 GAGCGCGCCGTCCCCCGCGCAGG - Exonic
1062305905 9:135907126-135907148 GAGCGGCCGCGCCGCCGCCGAGG - Exonic
1062406671 9:136400012-136400034 GCGCTGCCCCGCCCCCGTCCCGG + Intergenic
1062490054 9:136800566-136800588 GAGCCGCCCCGCACCCGCCAGGG + Exonic
1062659040 9:137618942-137618964 GATCGGCCCCGCCCCGACTCTGG + Intergenic
1185778811 X:2828855-2828877 GAGAGGACCCGCGCCCGCGGGGG + Exonic
1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG + Intergenic
1189325661 X:40109412-40109434 GTGCTGCCCCTCCCCCACGCCGG + Intronic
1190881549 X:54495680-54495702 CCCCGGCCCCGGCCCCGCGCGGG + Exonic
1194708149 X:97200609-97200631 GAGAGGCCCCGCCCCTGAGTAGG - Intronic
1199617581 X:149670230-149670252 GAGTGGCTCCTCCCCCGTGCAGG - Intergenic
1199625062 X:149733019-149733041 GAGTGGCTCCTCCCCCGTGCAGG + Intergenic
1199815944 X:151397067-151397089 GTGAGCGCCCGCCCCCGCGCCGG + Intronic
1201634877 Y:16111833-16111855 GAGAGGCCCCGCTCCCCTGCTGG + Intergenic