ID: 945227522

View in Genome Browser
Species Human (GRCh38)
Location 2:207547266-207547288
Sequence CAAAATCACTACATCCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945227522_945227524 16 Left 945227522 2:207547266-207547288 CCCATTTGGATGTAGTGATTTTG 0: 1
1: 0
2: 0
3: 15
4: 229
Right 945227524 2:207547305-207547327 TTTCTTAAGTAAATGTAAGTAGG 0: 1
1: 0
2: 2
3: 46
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945227522 Original CRISPR CAAAATCACTACATCCAAAT GGG (reversed) Intronic
904173869 1:28611432-28611454 CAACATCCCTATTTCCAAATAGG - Intronic
906691153 1:47793475-47793497 CAAAATCAGGACATCCACAAGGG + Intronic
907015650 1:51010174-51010196 GAAAATCACCACATCCAATCTGG - Intergenic
907771629 1:57471280-57471302 CAAACTCACCCCTTCCAAATGGG + Intronic
910749116 1:90608852-90608874 CAAGTTTACTATATCCAAATAGG + Intergenic
911791174 1:102016909-102016931 CAAAATTACTATGTCCAAAAAGG + Intergenic
912047826 1:105482588-105482610 CAAATTCCTTACATCCAAATTGG - Intergenic
912249562 1:107996904-107996926 CAGAATCAGTAAATCCATATGGG + Intergenic
912519787 1:110237470-110237492 CAAAATTACCAAATCAAAATGGG + Intronic
913060521 1:115201322-115201344 CAAAATCAATATACACAAATCGG + Intergenic
914239307 1:145841637-145841659 CAAAATCACAACACCAAAGTTGG - Intronic
914852991 1:151328420-151328442 CAAAAACACGCCATGCAAATGGG + Intergenic
917963315 1:180162765-180162787 AAAAATCACTTGATCAAAATAGG + Intronic
919181748 1:194093330-194093352 CAAAATTATTATATCCAAAAAGG + Intergenic
922038826 1:221875852-221875874 GAACATTACTACATCCATATAGG + Intergenic
923366985 1:233272230-233272252 CACAATCTATACATCCAAAAAGG + Intronic
924631216 1:245742732-245742754 CAGAAACACTACCCCCAAATTGG - Intergenic
1063792942 10:9475669-9475691 AAAAAGGAATACATCCAAATAGG + Intergenic
1064284791 10:13982816-13982838 CAAAATCAGTACATTCATAGAGG - Intronic
1065680037 10:28220709-28220731 CATCATCTCTACAACCAAATAGG - Intronic
1066020569 10:31295984-31296006 CAAAATCAATACACAAAAATTGG - Intergenic
1066330470 10:34416181-34416203 CAAAATCACAAGATGTAAATGGG + Intronic
1067408180 10:46042206-46042228 CAATATCATTACATACCAATGGG + Intronic
1068058920 10:52041864-52041886 CAAAATCAATATATTTAAATTGG + Intronic
1068398008 10:56489030-56489052 CAAAGTCACCAGATCCTAATAGG + Intergenic
1069419407 10:68233149-68233171 CAAGAAAACTACCTCCAAATAGG + Intergenic
1071456870 10:85857715-85857737 CAAAATCACCAGATAAAAATAGG + Intronic
1073679077 10:105682410-105682432 CAAAAACACTACAACAAAAATGG - Intergenic
1078540658 11:12210617-12210639 CAACAGTACTACATCCAAGTTGG - Intronic
1078554546 11:12311014-12311036 CAAAATCAATATATAAAAATTGG - Intronic
1079960001 11:26912361-26912383 CAATATCACAACATTCACATAGG + Intergenic
1080045860 11:27807112-27807134 CAAAATAAGTACATTCTAATGGG + Intergenic
1081754769 11:45536743-45536765 CAAAAACACCGCTTCCAAATAGG + Intergenic
1082145331 11:48660227-48660249 CAAAATCAGTATTTCCAAACTGG - Intergenic
1085961255 11:81465314-81465336 CAATAGCACTACATCTAAAAAGG - Intergenic
1086944112 11:92828286-92828308 CAAAAATACTATTTCCAAATTGG + Intronic
1087446125 11:98255761-98255783 CACAATCCCTTCATCCAAAATGG - Intergenic
1089771184 11:120804342-120804364 GAAAATCAGTACATCCACACAGG + Intronic
1089948329 11:122501263-122501285 AAAAGGCACTACATCCAAAGGGG - Intergenic
1090864306 11:130683825-130683847 CAAAATCAATATATAAAAATCGG - Intronic
1092997777 12:13966293-13966315 CAATATTATTACATCCAATTTGG + Intronic
1093751675 12:22807296-22807318 CAAAATCCCTTATTCCAAATAGG - Intergenic
1094338705 12:29386991-29387013 CAAAGTCAGCACATCCAAAATGG + Intergenic
1094789614 12:33896660-33896682 CAAAATTAATGCATACAAATTGG + Intergenic
1095155056 12:38842969-38842991 CATAAACACTACATCCTAACTGG + Intronic
1095198235 12:39349463-39349485 CAGAATCAATGCATCCAAACAGG + Intronic
1099088230 12:78273920-78273942 CAAAAAAAAGACATCCAAATAGG - Intergenic
1099860935 12:88225221-88225243 CAAAAGCAATACAGACAAATGGG - Intergenic
1099876820 12:88418078-88418100 CAAAATCATTCCAGCCAAAGTGG - Intergenic
1100094321 12:91013211-91013233 CAAAATCAACACATAAAAATCGG - Intergenic
1100242760 12:92726324-92726346 CAAAATCACCCTATCCAAAAGGG + Intronic
1101304568 12:103514758-103514780 TAAAACCCCTAAATCCAAATTGG + Intergenic
1102144152 12:110641994-110642016 CAAAATCACTACATCTGTTTAGG - Intronic
1105228336 13:18460262-18460284 CAAAATAATTACAGCCATATAGG - Intergenic
1106990307 13:35411231-35411253 CAAAATCAATGCACCCATATTGG - Intronic
1107142136 13:37011376-37011398 GAAATTCACTACCTCTAAATTGG + Intronic
1107361526 13:39623130-39623152 ATAAATCAGAACATCCAAATTGG + Intergenic
1107371190 13:39750599-39750621 CAAAATCAATACATTGACATTGG + Intronic
1111482798 13:88853848-88853870 CAAAATCAACAAATACAAATCGG + Intergenic
1116515650 14:45801946-45801968 CAAAATAACCACATCAATATAGG - Intergenic
1117515845 14:56500384-56500406 CAAAACCACCAAAACCAAATGGG - Intronic
1117681817 14:58211258-58211280 CAAAATCAATACAACAAAACCGG - Intronic
1117837423 14:59821490-59821512 AAAAAGAAATACATCCAAATAGG - Intronic
1117889484 14:60403178-60403200 CAAATCAAATACATCCAAATGGG + Intronic
1119928953 14:78525620-78525642 CATAATCACTTCATCCCATTGGG + Intronic
1119962233 14:78872642-78872664 GAAATTCACTAAATCTAAATAGG + Intronic
1120009408 14:79396475-79396497 CAAATTCAGTACATCCAGAGCGG + Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124109844 15:26774848-26774870 CAAAAGAACTGCATGCAAATAGG - Intronic
1127024420 15:54787513-54787535 CAAAAACAATACATCTGAATGGG - Intergenic
1127688427 15:61371197-61371219 CAAATTCACTGCATGAAAATAGG + Intergenic
1128774547 15:70309688-70309710 CAAAATCACTAAGTCCAGCTGGG - Intergenic
1128958901 15:71979091-71979113 CAAAATCACTATTTGCAGATTGG - Intronic
1130430054 15:83838612-83838634 GAAAAGATCTACATCCAAATAGG - Intronic
1130782035 15:87050425-87050447 CAAAAGCATTACATGCATATGGG - Intergenic
1131762602 15:95640725-95640747 TAAAATGAATGCATCCAAATTGG - Intergenic
1131898355 15:97059197-97059219 CAAAATGACTGAATGCAAATTGG - Intergenic
1132992442 16:2803061-2803083 AAAAATCACTGGATCCAGATAGG - Intergenic
1136054072 16:27674915-27674937 CAAAATCTCATCATCTAAATTGG + Intronic
1137042208 16:35623555-35623577 TTAAATCACTTCATCCAGATGGG + Intergenic
1137347217 16:47675290-47675312 CAGAATCACCACATCCAACGAGG - Intronic
1137638014 16:50004221-50004243 CATTATCACTACATCATAATGGG + Intergenic
1143624991 17:8104524-8104546 TTAAATCATTACATCCTAATAGG - Intronic
1144490653 17:15705257-15705279 CAAAATCAGGACATTCACATTGG + Intronic
1151094088 17:71476392-71476414 CAAAATAACTAGTTCCATATAGG + Intergenic
1153880981 18:9421594-9421616 CAAAATTACTAAATTAAAATTGG + Intergenic
1154061871 18:11069694-11069716 AGAAATCAATACATCAAAATTGG + Intronic
1154478867 18:14796869-14796891 CAGAATTACTTCATCCACATGGG - Intronic
1155759348 18:29546476-29546498 CAAAATCAACACATCCGAAATGG + Intergenic
1155791489 18:29976263-29976285 GAAAATCAAAACTTCCAAATAGG - Intergenic
1157976705 18:52336119-52336141 CAAAATACCTACATCCGAATCGG - Intergenic
1160105960 18:75976375-75976397 ATAAATCTCTACTTCCAAATGGG - Intergenic
1164273441 19:23694708-23694730 CAAAATCAATGTATACAAATCGG - Intergenic
1165278423 19:34774460-34774482 TAAAAGCATTACATCCAAAGAGG + Intergenic
925253746 2:2464671-2464693 CAAAATGACCACATTCAAAATGG - Intergenic
928773874 2:34735354-34735376 CAAAACTATTACAACCAAATAGG - Intergenic
930046720 2:47178872-47178894 TAAAATCACTGCATACTAATGGG - Intergenic
930287903 2:49456726-49456748 CAGCATCACTGCATCCAGATAGG + Intergenic
930808470 2:55517062-55517084 CTAAATCTCTAAATCTAAATGGG - Intergenic
933507299 2:83194120-83194142 CAAACTCACTAAATCTTAATGGG + Intergenic
938274579 2:130006478-130006500 CATTATCAATACATTCAAATTGG - Intergenic
938440788 2:131330794-131330816 CATTATCAATACATTCAAATTGG + Intronic
940241664 2:151569914-151569936 CAAAATCACCAAATCCAAGAAGG - Intronic
940519969 2:154733027-154733049 CAAAATGTATACATACAAATAGG - Intronic
941091903 2:161186365-161186387 AAAAACCACTCCAACCAAATGGG - Intronic
941307690 2:163891831-163891853 CAAATGCACTAATTCCAAATGGG + Intergenic
941316575 2:164000452-164000474 CATAACCACTGCAACCAAATTGG - Intergenic
941395838 2:164971655-164971677 CAATACCACTCCATCCAAAATGG - Intergenic
941742074 2:169045641-169045663 CAAATAAAATACATCCAAATTGG + Intergenic
942771795 2:179530370-179530392 CTAAATCTCCAAATCCAAATAGG + Intronic
943004592 2:182374723-182374745 CAATATCACTATAGCCAAAAGGG + Intronic
943458657 2:188141412-188141434 CAAAATTAGTACCTCCAAAAAGG + Intergenic
944178412 2:196860029-196860051 GAAAAAAAGTACATCCAAATTGG + Intronic
945227522 2:207547266-207547288 CAAAATCACTACATCCAAATGGG - Intronic
945627711 2:212231761-212231783 CAAAATAAATACATGCATATTGG - Intronic
945957844 2:216102857-216102879 TAAAATCATTACATACATATAGG - Intergenic
946228490 2:218277509-218277531 CAAAATCACCACTTCCAGAGGGG + Intronic
946490037 2:220139925-220139947 GAAAATCCATTCATCCAAATGGG + Intergenic
947253583 2:228136355-228136377 TAAAATCACTACTTCAAATTTGG - Intronic
947948808 2:234129930-234129952 CAAAATCTCTAAATCTAAGTTGG - Intergenic
1169593148 20:7167176-7167198 CAGAAACACTACATAGAAATTGG - Intergenic
1169999581 20:11599890-11599912 CAAAATCAGCACATAAAAATTGG + Intergenic
1170036533 20:11995822-11995844 GAATATCACTACATGCAAACAGG + Intergenic
1170924397 20:20709728-20709750 GAAAGTATCTACATCCAAATTGG + Intronic
1171863848 20:30459962-30459984 CAAAAAGACTCTATCCAAATTGG + Intergenic
1172607847 20:36226958-36226980 CAAAATTACTACATCCTAACTGG - Intronic
1174057967 20:47811692-47811714 CAAAACGTCTTCATCCAAATAGG - Intergenic
1174214070 20:48902818-48902840 CAACATCACTACCCCCAAAAAGG + Intergenic
1176772316 21:13088442-13088464 CAAAATAATTACAGCCATATAGG - Intergenic
1178062907 21:28872001-28872023 CAAAGTCCCTAATTCCAAATAGG + Intergenic
1181373326 22:22435832-22435854 CAAATCCAGGACATCCAAATTGG - Intergenic
1182244239 22:28942855-28942877 CAAAATGTCTACATCCCAAAAGG - Intronic
1182950225 22:34367630-34367652 AGAAATAAGTACATCCAAATAGG - Intergenic
1183791083 22:40069884-40069906 CAGAAACACTCCAGCCAAATAGG - Intronic
949284057 3:2380648-2380670 CAAATTCAGTATATCCAGATTGG + Intronic
949601560 3:5604237-5604259 CAAAATCAGTATATGAAAATTGG + Intergenic
950915299 3:16638414-16638436 CATAATCACTACATGCAAAGTGG - Intronic
951581059 3:24163252-24163274 CAAACTCACTAAATCAAAACAGG - Intronic
952227398 3:31392399-31392421 CAGCATCTCTACATCCAAAATGG + Intergenic
953170488 3:40502407-40502429 CAAAAACACAACATCCCAAGTGG - Intergenic
956870373 3:73411349-73411371 GAAAATCACAACATGCAAAGTGG + Intronic
957446362 3:80316645-80316667 CAAATTCACCACAATCAAATTGG + Intergenic
960188502 3:114673832-114673854 AAAAATCATTACCTACAAATAGG - Intronic
960243449 3:115372952-115372974 CAAAATAACTACCTCCATGTGGG + Intergenic
963805558 3:149718214-149718236 CATAATCACCACATCAAACTTGG + Intronic
963933640 3:151030090-151030112 CAAAATCAATACATATTAATGGG + Intergenic
964716696 3:159730251-159730273 CAAAATACCTCAATCCAAATGGG + Intronic
965345493 3:167543970-167543992 CAAAATCAATATATAGAAATTGG + Intronic
965752902 3:171995467-171995489 CCAAATCACAAAATCTAAATAGG + Intergenic
966509727 3:180748379-180748401 GAAAATAATCACATCCAAATGGG - Intronic
970473053 4:16395557-16395579 TAAAATCATTACAGCCAACTTGG - Intergenic
971576033 4:28276029-28276051 CAAAATCACTACGTCCCAACTGG - Intergenic
973917230 4:55647828-55647850 CAAATTGACTACAACAAAATAGG - Intergenic
975303425 4:72819139-72819161 CAATAACACTATATCAAAATTGG + Intergenic
976774132 4:88688622-88688644 CAAAATCAATATATTCAAAATGG - Intronic
977009731 4:91622354-91622376 CAAAATCATTACACAGAAATTGG + Intergenic
977813870 4:101390594-101390616 CAAAATCAATGTATGCAAATTGG + Intergenic
985972301 5:3388122-3388144 CAATGTCACTACATGCAAAGTGG + Intergenic
986172331 5:5324971-5324993 CAACATCACAACATCCAACTGGG + Intergenic
988311335 5:29562028-29562050 TAAAAGCAGTACATCTAAATAGG - Intergenic
990614483 5:57493523-57493545 AAAAAGCACTACATCTAGATAGG - Intergenic
990683620 5:58274628-58274650 CAGAATCACTACCTAGAAATAGG + Intergenic
990835542 5:60015182-60015204 CAAAATCACATAATCTAAATTGG - Intronic
991352923 5:65737767-65737789 TAAAATGACTAAATCTAAATTGG - Intronic
993433435 5:87861151-87861173 CAAAATCAATATACACAAATTGG + Intergenic
995907910 5:117148263-117148285 CATAATCAATACATGCATATTGG + Intergenic
996098009 5:119419650-119419672 CAAAATCACATCTTACAAATCGG - Intergenic
996468851 5:123835830-123835852 CAAAATCACTACATACTTTTAGG - Intergenic
997833498 5:137173247-137173269 CAAATTCACTACAGCCAAGAAGG + Intronic
999929948 5:156420831-156420853 CAGAATCATAACATCCAAAATGG - Intronic
1001094423 5:168765308-168765330 CAAAATCATTTCATTAAAATGGG - Intronic
1002985369 6:2185435-2185457 CAAAATAATTACTTCTAAATTGG + Intronic
1003566010 6:7222805-7222827 AAAAATCACTACAACCATAGAGG + Intronic
1004209101 6:13619428-13619450 CCAAATCATTACTTGCAAATCGG + Intronic
1004472974 6:15945680-15945702 CAAACTCACTACTTTCATATTGG - Intergenic
1005146531 6:22697386-22697408 CAAACTCATTACAATCAAATGGG + Intergenic
1005203718 6:23377019-23377041 CAAAATCAATACAGAAAAATTGG - Intergenic
1006573827 6:35028151-35028173 GAAAATAACTAGATCCAAAGTGG - Intronic
1006917918 6:37607723-37607745 CAAAATCCCTATTTCCAAATAGG + Intergenic
1007245216 6:40456870-40456892 CAAAATGACTACAACCAAGTGGG - Intronic
1008256022 6:49300874-49300896 CAAAAACAATACATTGAAATTGG - Intergenic
1008316019 6:50042215-50042237 CAAAATCACAAGATGCAAATAGG + Intergenic
1010602274 6:77844350-77844372 CAAAATCTCTCCATCTACATTGG + Intronic
1010660672 6:78567202-78567224 GAAAATAAAAACATCCAAATTGG + Intergenic
1010867602 6:80998740-80998762 TAATATCAATACCTCCAAATTGG + Intergenic
1012724597 6:102794071-102794093 CAAAATGACTACATTCAAGAGGG - Intergenic
1013858063 6:114598987-114599009 CAAAATTACTACAGAAAAATAGG - Intergenic
1017669908 6:156761088-156761110 GAAAATCAGTACATACATATTGG - Intergenic
1025853962 7:65262716-65262738 CAGCATCACTGCATCCACATGGG + Intergenic
1027430451 7:78106869-78106891 CAAAATAAATACAGACAAATGGG - Intronic
1027655971 7:80931230-80931252 CAAAATCAGTACATTTAAGTTGG + Intergenic
1027890696 7:83969790-83969812 CAAAATCAAAAATTCCAAATAGG + Intronic
1028172997 7:87621519-87621541 CAAAAACACTACAGAAAAATTGG + Intronic
1030022009 7:105284823-105284845 CACAAACACTTCAGCCAAATGGG + Intronic
1030529113 7:110690618-110690640 CAAAATCAATATACACAAATTGG + Intronic
1031310292 7:120188043-120188065 TAAAATCACTACAGTTAAATAGG - Intergenic
1031408790 7:121418317-121418339 CACACACACTACAGCCAAATAGG + Intergenic
1031516278 7:122702981-122703003 GAAAATTATGACATCCAAATGGG + Intronic
1031819027 7:126475289-126475311 CAAAATCAATATATAAAAATCGG + Intronic
1034336665 7:150328260-150328282 CAAAATCCCTACTTCAATATGGG + Intronic
1035558528 8:587054-587076 CCAAATGACTACATGGAAATTGG - Intergenic
1037713885 8:21380025-21380047 AAAACTCATCACATCCAAATAGG - Intergenic
1038700700 8:29846998-29847020 CAAAATCACCACATCAGAGTGGG - Intergenic
1039965724 8:42282103-42282125 CATAATCACTACATTCAATCTGG + Intronic
1040806376 8:51401504-51401526 CAAAGTCACTGCCTCCAAATGGG + Intronic
1044756425 8:95466972-95466994 CAAAATCAGGACATCCAAAATGG - Intergenic
1044851041 8:96428086-96428108 CAAAAGAAAGACATCCAAATTGG - Intergenic
1045054960 8:98361006-98361028 CAAAATCACAAGGTCAAAATTGG + Intergenic
1047284615 8:123476817-123476839 CAAAATGACTACTTTGAAATAGG - Intergenic
1048779138 8:137982161-137982183 CAAAATCACTATCTCCAAGAAGG - Intergenic
1050005916 9:1130240-1130262 CAAAATCATTCAATCCAAATTGG - Intergenic
1050726860 9:8659995-8660017 CAAAACAACTTCATCCAAATTGG + Intronic
1050734123 9:8743875-8743897 CAAAATCCATACATCGACATAGG + Intronic
1051090520 9:13402447-13402469 CAAAATACCTACACCCAACTGGG - Intergenic
1051286880 9:15506705-15506727 CAAGAGCACAACATCCAAAAGGG + Intronic
1052599789 9:30610899-30610921 CAAAATAACTGCTTCAAAATAGG - Intergenic
1052686183 9:31759764-31759786 CAAAATCAACATATACAAATTGG - Intergenic
1053405216 9:37868478-37868500 CAAAATGATTACATCTAAGTAGG - Intronic
1055111459 9:72563958-72563980 CAAACTCAATACATTCCAATAGG - Intronic
1055766416 9:79668297-79668319 CAAAAGCATTAGATACAAATGGG + Intronic
1057451403 9:95164238-95164260 CAAATTCTTTCCATCCAAATTGG - Intronic
1058755690 9:108081043-108081065 CAAAATCATTAGATACAAAAAGG + Intergenic
1059088196 9:111327687-111327709 CAAAATCACCACAGTCAAATGGG + Exonic
1060262980 9:122092493-122092515 CAAAATCACTTCCTCCAAGAGGG - Intronic
1060507203 9:124206962-124206984 CAAAATCACCAAATACACATCGG - Intergenic
1060556438 9:124510069-124510091 CAAAATCATTGCATTAAAATAGG - Intergenic
1186360190 X:8833035-8833057 TAAAATATTTACATCCAAATGGG - Intergenic
1186606855 X:11101261-11101283 CTAAATCACTAAATCCAGAAAGG + Intergenic
1186680968 X:11873954-11873976 CAGAATCACTTCATCCCAGTAGG + Intergenic
1187749897 X:22450849-22450871 AAAGAAAACTACATCCAAATTGG + Intergenic
1188190728 X:27168900-27168922 CAAAGGCACTGCAGCCAAATTGG - Intergenic
1189699292 X:43700350-43700372 CAAAATCACTTTATCCCAACAGG + Intronic
1189817373 X:44837208-44837230 CAAAATCAATGTATACAAATTGG + Intergenic
1191267262 X:58410650-58410672 CAAAAACAGTACTTCCAAACTGG + Intergenic
1193839729 X:86395185-86395207 GAAAATTATTTCATCCAAATGGG - Intronic
1194287666 X:92030429-92030451 CATAATAATTACATCAAAATAGG + Intronic
1195815974 X:108888352-108888374 CAAAATCAACACACACAAATTGG + Intergenic
1195825494 X:108995498-108995520 CATGAACACTACATACAAATAGG - Intergenic
1196499809 X:116366532-116366554 CAAAAAGACTAGATCAAAATTGG - Intergenic
1198930670 X:141855905-141855927 CAAAAACAGTGCATCCAAGTTGG + Intronic
1199271666 X:145890602-145890624 CAAAATAAAAGCATCCAAATTGG - Intergenic
1200605199 Y:5254989-5255011 CATAATAATTACATCAAAATAGG + Intronic
1201693787 Y:16800263-16800285 CCAACTCCCTACTTCCAAATTGG - Intergenic
1201701950 Y:16892602-16892624 CAAATTCACTACTTACCAATGGG - Intergenic
1202070943 Y:20990886-20990908 CAAAAGCACTACAGAGAAATTGG + Intergenic