ID: 945228635

View in Genome Browser
Species Human (GRCh38)
Location 2:207559635-207559657
Sequence GTTTTAATGAGTCAATACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945228635_945228638 6 Left 945228635 2:207559635-207559657 CCTGGGTATTGACTCATTAAAAC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 945228638 2:207559664-207559686 AGTTCTAGACTTAGTAGGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 202
945228635_945228636 1 Left 945228635 2:207559635-207559657 CCTGGGTATTGACTCATTAAAAC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 945228636 2:207559659-207559681 GCCTTAGTTCTAGACTTAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945228635 Original CRISPR GTTTTAATGAGTCAATACCC AGG (reversed) Intronic
907695367 1:56721303-56721325 GTTATAAACAGACAATACCCTGG - Intronic
910244275 1:85122167-85122189 GTTTCAATAATTCAATAACCTGG + Intronic
910869868 1:91823365-91823387 GTTTTCTTGAGTAAATACCTAGG - Intronic
912320729 1:108710435-108710457 TTTTTTTTGAGTCAATACCTAGG + Intergenic
914219847 1:145670428-145670450 ATTTTAATGAGTCAATCTCAAGG - Exonic
914472428 1:147993305-147993327 ATTTTAATGAGTCAATCTCAAGG - Exonic
919693821 1:200551839-200551861 GTTTTTATTAGTCAATAATCTGG - Exonic
1063989304 10:11543089-11543111 GTAATAATGATTGAATACCCAGG - Intronic
1067905418 10:50285791-50285813 TTTTTCATGCGTAAATACCCAGG - Intergenic
1070627313 10:78060550-78060572 GTTCTAATGGCTTAATACCCTGG - Intergenic
1072447607 10:95513177-95513199 GTTTCACTGCGTCAAGACCCAGG - Intronic
1082649806 11:55775928-55775950 CTTCTAATGGGTAAATACCCAGG - Intergenic
1085890789 11:80576112-80576134 GTTTTTATGAATAAATGCCCTGG - Intergenic
1086814069 11:91346848-91346870 GTTCTAATCAGTCAATACCAGGG - Intergenic
1086860527 11:91919983-91920005 GTTCTATTGAGTATATACCCAGG - Intergenic
1087818557 11:102686141-102686163 GTTTAAATGAGACAATAAACAGG + Intergenic
1095352193 12:41226935-41226957 GTTTTTATGATCTAATACCCAGG + Intronic
1097622291 12:61954513-61954535 GTTTTAATTAGTAACTACACAGG - Intronic
1097723773 12:63051405-63051427 GATTCAATGAGTTAATACACAGG - Intergenic
1098617621 12:72548834-72548856 GTTGTTATGAGTCAACACCAGGG + Intronic
1105613467 13:21990158-21990180 GTTTTAGTGGGTAAATACCTAGG + Intergenic
1106483265 13:30152689-30152711 GTTCTAATGAGCCAAAGCCCAGG + Intergenic
1108638123 13:52356559-52356581 GTTTTAATGATGTAATCCCCTGG - Intergenic
1111843639 13:93480946-93480968 TTTTTAGTGAGTGAATACCTAGG + Intronic
1118240608 14:64053905-64053927 GTTGTAATGAGTCAACATCCCGG + Intronic
1128604342 15:69025852-69025874 GTTTTAGACAGCCAATACCCTGG + Intronic
1138082775 16:54107525-54107547 GTTTTCATGGGTTCATACCCAGG + Intronic
1138269419 16:55684469-55684491 ATTCTATTGAGTCAATACCTAGG + Intronic
1144240502 17:13306497-13306519 CTTTTAAAGAGTCCATACCAAGG + Intergenic
1162592417 19:11600982-11601004 TTTTCAATGAGAAAATACCCAGG - Intronic
926523678 2:13949791-13949813 GTTTTAATGCGACTAGACCCAGG - Intergenic
930450365 2:51528317-51528339 TTTTTATTGAGTAAATACCTAGG + Intergenic
930518638 2:52436130-52436152 GTTTTAGTGAGTACATACTCTGG + Intergenic
930540316 2:52697695-52697717 GTTTTAATGAGTTATTAGCAGGG + Intergenic
933216864 2:79640831-79640853 GTCTTAATGAGTTTATAACCTGG + Intronic
933640276 2:84751522-84751544 GTTCTAATGAGCCTATACCATGG - Intronic
934520025 2:95014248-95014270 GTGTCAATGAATCAATTCCCAGG + Intergenic
939719531 2:145631424-145631446 GTTTTAATTAGTAAATTCACTGG + Intergenic
940545822 2:155083547-155083569 GTTTCAATTATTCAATACCTGGG - Intergenic
943176032 2:184475486-184475508 GTTCTAGTGAGACAATTCCCAGG + Intergenic
943548012 2:189305477-189305499 GTAATAATGAGTCATTACCTTGG + Intergenic
945228635 2:207559635-207559657 GTTTTAATGAGTCAATACCCAGG - Intronic
1171177306 20:23062227-23062249 ATTTAAATGAGTCAGTCCCCGGG + Intergenic
1176360777 21:5995212-5995234 GTAATAATGACTCAAGACCCTGG + Intergenic
1178242693 21:30921193-30921215 CTTTCAATCAGTCAATGCCCAGG + Intergenic
1179762741 21:43543338-43543360 GTAATAATGACTCAAGACCCTGG - Intronic
1183799380 22:40149042-40149064 TTTTTATTGAGTAAATACCTAGG - Intronic
1184950173 22:47836110-47836132 GGGTTGATCAGTCAATACCCTGG + Intergenic
1184992608 22:48180854-48180876 GCTCAAATGAGTCAATGCCCTGG + Intergenic
949318625 3:2784815-2784837 GTTTTAAGAATTCAATACCATGG + Intronic
950049790 3:9978907-9978929 GTTTTAAACAGTCAGTACCCCGG + Intronic
952377502 3:32779970-32779992 GTTTTAATGTGTCAACATCCTGG + Intergenic
954973045 3:54667522-54667544 GTTTTCAAGGTTCAATACCCTGG - Intronic
957963069 3:87285112-87285134 GTATTAACTAGTCAATACACAGG - Intergenic
963004217 3:140710915-140710937 GTTCAAATGAGTCATTACCCTGG - Intergenic
968670956 4:1851292-1851314 GTTGCAATGAGTCAACAGCCAGG + Intronic
969994590 4:11298950-11298972 CTTCTAATGTGTCAAGACCCAGG + Intergenic
970615417 4:17764255-17764277 GTTTTAATGAGCAAATATGCAGG - Intronic
975203922 4:71623139-71623161 GCTTAAATGAGTTAATACCTTGG - Intergenic
976430783 4:84961947-84961969 GTTTTCTTGAGTTAATACCTAGG - Intronic
979235056 4:118390463-118390485 ATTTTAATGTGTCAATTCCGTGG - Intergenic
979453582 4:120901366-120901388 GTTGTAATGACTAATTACCCTGG + Intronic
988910229 5:35832904-35832926 GTGATAATGAGTCAACACTCAGG - Intergenic
990106916 5:52275694-52275716 ATTTTACTGAATCAATACCAGGG + Intergenic
993515754 5:88832556-88832578 TTTTTAATCAGTCATTTCCCTGG - Intronic
994934809 5:106240503-106240525 GTTTTAATGATTCAAGAACATGG + Intergenic
996238784 5:121169284-121169306 TTTTTACTATGTCAATACCCTGG + Intergenic
996622183 5:125520476-125520498 GTTTTAATGAGTCAACAGAGAGG - Intergenic
999281146 5:150366985-150367007 GATTTAAGGAGACAATACCCTGG + Intronic
1000830740 5:166098099-166098121 GTTTTCATGAGTAAATTTCCTGG - Intergenic
1005432983 6:25777859-25777881 GTTTGAAAGTCTCAATACCCGGG - Intronic
1006290087 6:33128173-33128195 GGTTTTATGTGTCTATACCCTGG + Intergenic
1008057307 6:46958497-46958519 GTTTTAGTGAGTCCAAACCTAGG - Intergenic
1008864600 6:56194296-56194318 GTTTTAATGATTAAATAACATGG - Intronic
1010189023 6:73175629-73175651 GTTTTAAAGAGTCTATAGTCAGG - Intronic
1010911009 6:81556438-81556460 GTTCTAATGTGACCATACCCTGG + Intronic
1015138021 6:129895695-129895717 GATTGAATGAGTTAATACACAGG + Intergenic
1017597492 6:156044933-156044955 ATTTTACTGAGTGAATACCAAGG - Intergenic
1017628736 6:156374985-156375007 GCTTTAAGGAGTCAATGCCTAGG - Intergenic
1021953949 7:25805146-25805168 GTTGTAATAAGTGAATACACAGG + Intergenic
1026387101 7:69860981-69861003 TTTTCAATGAGTCGATTCCCAGG - Intronic
1030067160 7:105668721-105668743 GTTTTAATTAGTAAGTAACCGGG - Intronic
1030909981 7:115235043-115235065 GTTTTAATCAGGGAAGACCCTGG - Intergenic
1034846316 7:154449579-154449601 GTTTTCGTGAGTCTATACCTAGG - Intronic
1034972398 7:155427439-155427461 GTCTTAATGAATCCACACCCAGG + Intergenic
1036152978 8:6315683-6315705 GTTGAAATGAGTCCATCCCCAGG + Intergenic
1039708911 8:40036011-40036033 GTTTCAATGACTCTATATCCTGG - Intergenic
1046190253 8:110786026-110786048 GTTTGAATGAGACTATATCCTGG + Intergenic
1046970354 8:120216194-120216216 ATTTTTATGAGACAATACACTGG + Intronic
1048880496 8:138868670-138868692 GATCTATTGAGTCAATACCTGGG - Intronic
1049396018 8:142401203-142401225 GTTTTGATGAATAAATACACTGG - Intronic
1050641983 9:7678043-7678065 GTTTTTATGACACAATTCCCAGG - Intergenic
1055368251 9:75569457-75569479 GTTTTAATGACTAAATGACCGGG - Intergenic
1186821803 X:13296441-13296463 GTATTTATGAGGCATTACCCTGG - Intergenic
1187092121 X:16107635-16107657 GCTATAATGAGTTAATACTCTGG + Intergenic
1187893954 X:23963587-23963609 GTTTTAATGAGTCATTCCTATGG - Intergenic
1188378335 X:29460694-29460716 GTTTTGATGGGTCAATGACCAGG - Intronic
1190534826 X:51415993-51416015 CTTTTCATGAGTGAATACCTAGG + Intergenic
1191027892 X:55935282-55935304 GCCTTAAAGAGTCTATACCCAGG - Intergenic
1198090377 X:133322913-133322935 CTTTCCATGAGTCAATACCAGGG - Intronic
1198629159 X:138616126-138616148 GTTTGAATGAGTTAATACTTTGG - Intergenic
1199188744 X:144946039-144946061 GTTTAAATGAGTTAATACATAGG - Intergenic