ID: 945230843

View in Genome Browser
Species Human (GRCh38)
Location 2:207587831-207587853
Sequence ATGGACACAAACTTACATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945230834_945230843 23 Left 945230834 2:207587785-207587807 CCTGGGAAGGGAAGGTGAGATAG 0: 1
1: 0
2: 1
3: 30
4: 347
Right 945230843 2:207587831-207587853 ATGGACACAAACTTACATCTAGG 0: 1
1: 0
2: 0
3: 31
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945230843 Original CRISPR ATGGACACAAACTTACATCT AGG Intronic
901040892 1:6362696-6362718 AGGGTCAGAAACTTACATCCAGG + Intronic
905323758 1:37135773-37135795 AAGGACACAAAATTACAGCTAGG - Intergenic
908384333 1:63626833-63626855 ATGGACACAGACTTTCAGTTTGG - Intronic
908620257 1:65971162-65971184 AGGCACAAAAACTTACATCTTGG + Intronic
911084275 1:93963541-93963563 AAGGACCCTAACTTACATTTGGG + Intergenic
912348194 1:108985502-108985524 ATGAACACAAATATACATTTTGG - Intronic
912825584 1:112900329-112900351 ATGTACAAAAATTTTCATCTTGG - Intergenic
915536103 1:156536512-156536534 ATGGGTACAAAGTTACATCCAGG + Intronic
916456758 1:164978970-164978992 ATAGGCACAAAATTAAATCTGGG + Intergenic
917908533 1:179614987-179615009 AAGGACACAAACTTTCAGTTAGG - Intronic
918452915 1:184676945-184676967 AAGGATACAAAATTACAGCTAGG + Intergenic
918545578 1:185680171-185680193 ATGGACACAAGTTCACCTCTAGG - Intergenic
918765953 1:188483528-188483550 AAGAACACAATGTTACATCTAGG - Intergenic
918816271 1:189189645-189189667 TAGGATACAAAATTACATCTAGG - Intergenic
919236592 1:194853152-194853174 AAGGAAACAAAATTACACCTAGG - Intergenic
923845325 1:237724164-237724186 ATGCACACACACATACATTTAGG - Intronic
1063939803 10:11116394-11116416 ATGTTCACACACTTACATGTAGG + Intronic
1066172575 10:32866925-32866947 AAGGACACAACATTACATCTGGG + Intronic
1066763440 10:38780590-38780612 ATGGATACAAAATTACAGCTAGG + Intergenic
1066958374 10:42195051-42195073 ATGGATACAAAATTACAGCTAGG - Intergenic
1071143820 10:82543683-82543705 ATATACAAAAACTTACCTCTTGG - Intronic
1071850626 10:89565920-89565942 ATGGATACATACTTACATATTGG - Intergenic
1072907420 10:99467297-99467319 ATGGACACAAACCTCCAGGTGGG + Intergenic
1078174266 11:8957616-8957638 TTGGAAACAAAGTTACAGCTTGG + Intronic
1079663386 11:23071299-23071321 ATGGGGACTAAGTTACATCTTGG - Intergenic
1079706717 11:23630463-23630485 ATGTACACACACGTACTTCTTGG - Intergenic
1080220130 11:29893338-29893360 AAGGACACAAAATTTCATCTAGG + Intergenic
1080423354 11:32133163-32133185 ATGGATACAAAACTACATATTGG - Intergenic
1080882777 11:36338370-36338392 ATGGAAACAAAATTACAGCTTGG - Intronic
1082755477 11:57071577-57071599 ATGGATACAAACTTACAGTTAGG + Intergenic
1084486451 11:69450969-69450991 ATGCACACAACCTTGCTTCTGGG + Intergenic
1085114232 11:73916174-73916196 ATGGAGCAAAACTTACATGTGGG + Intronic
1085443668 11:76584680-76584702 AAGGACACAAAATTTCATTTAGG + Intergenic
1085544939 11:77309538-77309560 ATAAACACAAATTTATATCTAGG - Intergenic
1086720483 11:90115138-90115160 ATGGATACAAAATTACAGCTAGG + Intergenic
1086765612 11:90691998-90692020 ATGGACAGAAACTTTCATGAAGG - Intergenic
1088095395 11:106094515-106094537 ATGTAAACAAAGTTACATCTAGG + Intronic
1088302202 11:108371176-108371198 ATGAACACACACTTATATCATGG - Intronic
1088779775 11:113123103-113123125 ATGGATACAAACATACAGTTAGG + Intronic
1090501462 11:127265341-127265363 ATGGACAGAAAGTTTCATATGGG + Intergenic
1091113793 11:132995296-132995318 ATGAAGGCAAACTTACATCTAGG + Intronic
1093341533 12:17981021-17981043 ATGGATACAAACAGACATATGGG + Intergenic
1098739115 12:74148496-74148518 TTGGTGACAATCTTACATCTTGG - Intergenic
1099388085 12:82042881-82042903 ATGGCCATAAACTTCCTTCTTGG - Intergenic
1099623127 12:85029540-85029562 AAGGATACAAAATTACAGCTAGG - Intronic
1099729091 12:86474595-86474617 AAATACACACACTTACATCTGGG + Intronic
1099789417 12:87312670-87312692 ATCTACACATACTTGCATCTTGG + Intergenic
1099840680 12:87961830-87961852 ATGGACACAAAAGTACAGCTAGG - Intergenic
1100859796 12:98792555-98792577 ATGGTAACAAACTTACAATTAGG - Intronic
1101269101 12:103124214-103124236 AAGGACAAAATGTTACATCTGGG - Intergenic
1104740403 12:131167992-131168014 ATGGACATAGACTTATACCTAGG - Intergenic
1106807000 13:33319798-33319820 CTGGACAAAAACTTAAAACTTGG + Intronic
1107027723 13:35820666-35820688 ATGGGAACAGACTTACAACTGGG - Intronic
1107639147 13:42423741-42423763 ATGAACTCAAACTTACAAGTAGG + Intergenic
1111653650 13:91126014-91126036 AAGGACACAAAATTTCATTTAGG - Intergenic
1111832816 13:93351470-93351492 AAGGATACAAAATTACAGCTAGG + Intronic
1114151449 14:20044460-20044482 CTGTACAGACACTTACATCTTGG + Intergenic
1114502227 14:23179039-23179061 ACGGACACAATCTTTGATCTAGG + Intronic
1114972440 14:28050079-28050101 ATAGACACATACCTAAATCTGGG + Intergenic
1116397320 14:44462290-44462312 TTGAACAAAAATTTACATCTCGG - Intergenic
1117025615 14:51616882-51616904 ATGCACACAAAGTCACCTCTAGG - Intronic
1119372228 14:74156752-74156774 ATGGATACAAAATTACAGCTAGG - Intronic
1119477807 14:74941274-74941296 TTGGAAACAAAACTACATCTTGG + Intergenic
1120423854 14:84322438-84322460 ATGGGCACAAACATACAGTTAGG + Intergenic
1123167349 14:106338686-106338708 AAGAACACAAACTTTCATTTAGG + Intergenic
1123169968 14:106363399-106363421 AAGAACACAAACTTTCATTTAGG + Intergenic
1202934751 14_KI270725v1_random:76831-76853 ATGGATACAAAATTACAGCTAGG + Intergenic
1124043806 15:26129038-26129060 ATGGACTTAAACTTTCATTTGGG - Intergenic
1124057872 15:26259336-26259358 ATGGATACAAAGTTACAGTTAGG - Intergenic
1126296398 15:47141503-47141525 ATGGATACAAAATTTCAGCTAGG + Intergenic
1127198975 15:56622855-56622877 ATGAACACATACTTACAACATGG + Intergenic
1129702811 15:77777402-77777424 ATGGACACACACACACAACTGGG + Intronic
1130394684 15:83491919-83491941 AAGGACACAGACTTACCTGTAGG + Intronic
1130437274 15:83913825-83913847 ATGTACACAAACATAAATCATGG - Intronic
1130899510 15:88196501-88196523 AGGAACACCTACTTACATCTGGG + Intronic
1132200643 15:99952360-99952382 ATGGACCAAAACTTTCATCCAGG - Intergenic
1134181583 16:12052216-12052238 TTACACACAAACTTACTTCTCGG - Exonic
1134335659 16:13297366-13297388 ATTGAAACAAACTTAGATCGTGG + Intergenic
1138979985 16:62256326-62256348 ATGCACAGCAACTTAAATCTAGG - Intergenic
1143727231 17:8857484-8857506 ATGAACACAAACTTCTGTCTGGG + Intronic
1144413913 17:15027769-15027791 ATGGGCACACACATACTTCTGGG + Intergenic
1144495240 17:15741601-15741623 ATGGGCAGACACTTCCATCTTGG - Intronic
1146783378 17:35696375-35696397 ATGGATACAAACATACAGTTAGG + Intronic
1147432543 17:40381761-40381783 GTGGGCACAAACTCACTTCTGGG - Intergenic
1149387841 17:56159522-56159544 ATGGGAACAAAATTATATCTGGG - Intronic
1150158475 17:62873883-62873905 AAGGATACAAAATTACAGCTAGG - Intergenic
1150574541 17:66418373-66418395 TTTGACACAACCTTAAATCTTGG - Intronic
1152422102 17:80199190-80199212 ATGGACACAAATATACAACCTGG + Intronic
1155459033 18:26055612-26055634 ATGCACACAAATTTGCATCTTGG - Intronic
1155547341 18:26929113-26929135 ATAGACACAAACATACACCATGG - Intronic
1155815594 18:30304647-30304669 ATTAACACCAACTTTCATCTGGG - Intergenic
1158690937 18:59659898-59659920 AGTGACACAAACTTAGAACTGGG - Intronic
1160319750 18:77879308-77879330 TTAGACAAAGACTTACATCTTGG - Intergenic
1163420530 19:17211542-17211564 GGGGACACAGAGTTACATCTAGG + Intronic
1165066431 19:33231760-33231782 CTGGACACAAGATTACATTTTGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
930356774 2:50330542-50330564 ATGGAGAGAAACTAACTTCTGGG - Intronic
934016728 2:87894477-87894499 ATGTACCCAAACTTAAACCTAGG + Intergenic
934306495 2:91827466-91827488 ATGGATACAAAATTACAGCTAGG - Intergenic
934326761 2:92025276-92025298 ATGGATACAAAATTACAGCTAGG + Intergenic
934465133 2:94255824-94255846 ATGGATACAAAATTACAGCTAGG + Intergenic
934911290 2:98257050-98257072 TTGGACACAAACATACAGTTAGG - Intronic
935320002 2:101877439-101877461 GTGGACACAGACCTACATATTGG - Intronic
937692730 2:124774179-124774201 AAGGAAACAAAGTTAAATCTGGG - Intronic
938837218 2:135118237-135118259 GTGGAACCCAACTTACATCTTGG + Intronic
939155501 2:138520423-138520445 ATGTACACAGACATACATTTGGG + Intronic
939422957 2:141997372-141997394 ATGTACACACACACACATCTTGG - Intronic
940419273 2:153459644-153459666 ATGAACACAAACAAACATATAGG + Intergenic
940556894 2:155240227-155240249 AAGGACACAAAATCACTTCTAGG + Intergenic
942944016 2:181653787-181653809 AAAGACACAAAGTTACAACTAGG + Intronic
944200630 2:197103820-197103842 ATGCACACATACATACAACTGGG - Intronic
944919020 2:204391051-204391073 ATGAATACGAACTTACAGCTAGG - Intergenic
945230843 2:207587831-207587853 ATGGACACAAACTTACATCTAGG + Intronic
947979877 2:234399642-234399664 ATGGCCACAAACATGCACCTTGG + Intergenic
1171054913 20:21897006-21897028 AATGTCACACACTTACATCTCGG + Intergenic
1173026916 20:39316209-39316231 AGGGACACAAACTGAAAGCTGGG + Intergenic
1173470476 20:43319816-43319838 AGGGAAAGAAACTTACATTTAGG + Intergenic
1176596165 21:8699044-8699066 ATGGATACAAAATTACAGCTAGG + Intergenic
1180279076 22:10676492-10676514 ATGGATACAAAATTACAGCTAGG + Intergenic
1180586287 22:16895023-16895045 ATGGATACAAAATTACAGCTAGG + Intergenic
1181332772 22:22107076-22107098 ATGAACATAAACTCACATCAAGG - Intergenic
1183341528 22:37284395-37284417 ATGGACACAGACCTACAGATGGG + Intronic
949400688 3:3662549-3662571 ATGGACACAAATTTAGTGCTGGG - Intergenic
951638526 3:24807464-24807486 AAGGATACAAAATTACAACTAGG + Intergenic
952345300 3:32478288-32478310 ATGGATACAAAGTTACAGTTAGG + Intronic
956240244 3:67122140-67122162 ATGGAGACCAACACACATCTTGG - Intergenic
956923693 3:73958697-73958719 ATGAAGAGAAAATTACATCTTGG + Intergenic
958051387 3:88351548-88351570 ACCTACACAAAGTTACATCTTGG - Intergenic
959765147 3:110017780-110017802 ATGAATACAAGCTAACATCTGGG + Intergenic
960028576 3:113035382-113035404 ATGCACACACACAAACATCTTGG - Intergenic
961725649 3:128927417-128927439 ATGGACAAAAAATTAATTCTAGG + Intronic
962193182 3:133332620-133332642 ATAGCCCCAAACTTAAATCTTGG + Intronic
962355246 3:134688395-134688417 ATGGACACAAAGCTACTTTTTGG + Intronic
962650536 3:137484487-137484509 ATGGGCACAAACATACAGTTAGG - Intergenic
963664304 3:148163209-148163231 AAGGATACAAAATTACAGCTAGG - Intergenic
966973250 3:185064498-185064520 AAGGACACAAAATTTCATTTAGG + Intergenic
967354145 3:188548900-188548922 AAGGAATCAAAATTACATCTAGG + Intronic
971027801 4:22605838-22605860 ATAGACACAAACATACACCATGG - Intergenic
971368527 4:25996379-25996401 ATGGATACAGACTTTCAGCTGGG - Intergenic
972006762 4:34119292-34119314 ATTGAGACAAACTTACAACCAGG - Intergenic
972192259 4:36609291-36609313 ATGTATACAATCTTACTTCTAGG - Intergenic
973966259 4:56165028-56165050 ATGGCCAGAAACTGCCATCTGGG - Intergenic
974615732 4:64278715-64278737 AAGGATACAAAGTTACAGCTTGG - Exonic
979577821 4:122316376-122316398 ATGGCCACAAACTCACCTTTGGG + Intronic
979912602 4:126387784-126387806 ATAGACACAAATATATATCTTGG - Intergenic
980212662 4:129809829-129809851 ATTGACACAACCTTCCATGTAGG + Intergenic
980459281 4:133084987-133085009 ATGGACACAAACTGAAATGCTGG + Intergenic
980977184 4:139622692-139622714 ATGGACACAAACTCCCTTCCTGG - Intergenic
981311569 4:143302864-143302886 AAGGACAGTAAATTACATCTTGG - Intergenic
986040161 5:3986483-3986505 AAGGAAACAAACTAACATGTTGG - Intergenic
986518521 5:8589052-8589074 ATGGACTCACACTTACAATTTGG + Intergenic
987706885 5:21469722-21469744 ATGGACACAAACTTACGATAGGG + Intergenic
988850210 5:35173215-35173237 ATGGACACCCACATACATGTTGG + Intronic
989252148 5:39329884-39329906 AAGAACACAAACTTACATGAGGG - Intronic
990330410 5:54719873-54719895 AGGGACACAAACTCTTATCTTGG - Intergenic
991137806 5:63203676-63203698 ATAGATACAAAATTACAGCTGGG - Intergenic
992304907 5:75426806-75426828 ATGGACACAGAGTTTCAGCTGGG + Intronic
993369682 5:87076758-87076780 GTAGACACAAACACACATCTTGG - Intergenic
993934063 5:93978897-93978919 ATGGATACAAACATACAGTTAGG + Intronic
995849493 5:116530521-116530543 TTGGAAACAAATTCACATCTGGG - Intronic
996298029 5:121947014-121947036 ATGGACATAAACATAGATCAGGG + Intergenic
1001259088 5:170211606-170211628 ATGGACACCACCTTTCAGCTTGG - Intergenic
1002061842 5:176629995-176630017 ATGCACACAAACATACACCACGG + Intronic
1003221294 6:4163231-4163253 ATGGCCACATGCTTCCATCTGGG - Intergenic
1007851270 6:44804796-44804818 ATGGAGACTAACTTTCATTTTGG - Intergenic
1008264280 6:49404954-49404976 ATTGACACAAACTTACACTAGGG - Intergenic
1008751627 6:54740620-54740642 ATAGACAAAAAATTACAACTTGG - Intergenic
1009438838 6:63651660-63651682 ATGGATACAAAATCACAACTAGG - Intronic
1010621522 6:78082515-78082537 ATGGGTACAAACTTACACTTAGG + Intergenic
1010668584 6:78658626-78658648 ATGGAGACAAACTTGCAAATTGG - Intergenic
1011951744 6:92975364-92975386 AAGGATACAAAATTACAGCTAGG + Intergenic
1012081992 6:94770870-94770892 AAGTACACAAACTGACACCTTGG - Intergenic
1013420616 6:109963244-109963266 ATGGGTACAAAATTACAGCTAGG + Intergenic
1014239637 6:119001052-119001074 ATGGACAAAACCTTCCTTCTTGG - Intronic
1018074355 6:160197917-160197939 AATGACACAAACTTACAGCTAGG + Intronic
1018807961 6:167275939-167275961 ATGGACACAAAATCACAGCTAGG - Intronic
1019835587 7:3379741-3379763 ATAGACACATACATACATATAGG + Intronic
1020372414 7:7446806-7446828 AAGGAGACAAACATGCATCTGGG + Intronic
1020917781 7:14218093-14218115 ATGAACACGAAGTTTCATCTGGG - Intronic
1022070253 7:26906164-26906186 ATGGATATAAAAATACATCTTGG + Intronic
1022785648 7:33634602-33634624 CTGGACAGAAACTCACACCTGGG - Intergenic
1024522731 7:50320536-50320558 AAGGAGACAAAATTACAGCTAGG - Intronic
1024899756 7:54305563-54305585 ATGTAAACAAACATATATCTTGG - Intergenic
1027485826 7:78760731-78760753 TTGCACACACACTTACATATCGG - Intronic
1027528729 7:79303174-79303196 AGGGACACAAAGCTACATTTGGG + Intronic
1027556185 7:79667494-79667516 TTGGTGACACACTTACATCTAGG + Intergenic
1028205899 7:88016816-88016838 ATGGATACAAAATTACAGCTAGG + Intronic
1029031414 7:97471359-97471381 CTGCACACAAACTTACTTATGGG + Intergenic
1029986592 7:104928475-104928497 TTGGACACAAACACACATATGGG + Intergenic
1032122206 7:129165102-129165124 ATGGATACAGAGTTTCATCTGGG - Intronic
1039414735 8:37384109-37384131 ATGGACTCAAAATTATATATAGG + Intergenic
1039733116 8:40301068-40301090 ATGGATAAAAACTCAAATCTGGG - Intergenic
1039788181 8:40852165-40852187 AAGGACACAAAATTATAGCTAGG - Intronic
1040414882 8:47187338-47187360 ATGGGCACAAACACACATCAAGG + Intergenic
1041087716 8:54272015-54272037 ATGGACAACAACCTCCATCTCGG + Intergenic
1042456322 8:69008119-69008141 ATGTACACAAACCTTCTTCTAGG + Intergenic
1042798390 8:72689518-72689540 ATGGACACAAGCTTTCTTTTTGG - Intronic
1044827017 8:96208451-96208473 TTGGACACAAACATATATTTTGG + Intergenic
1045076260 8:98572321-98572343 ATGAACACAAAGTTTAATCTAGG - Intronic
1048890310 8:138941063-138941085 ATGGACACACACTCACAACATGG - Intergenic
1050629014 9:7539225-7539247 ATGGACAAAAAGTTCCCTCTTGG - Intergenic
1050977361 9:11957340-11957362 ATGTACACACACTTAGTTCTAGG + Intergenic
1052334993 9:27309954-27309976 AAGGACACAAAATTTCAGCTAGG + Intergenic
1052581928 9:30368414-30368436 AAGGACACAAAGTTACAGTTAGG - Intergenic
1053695207 9:40632618-40632640 ATGGATACAACATTACAGCTAGG + Intergenic
1053942193 9:43263004-43263026 ATGGATACAAAATTACAGCTAGG + Intergenic
1054306451 9:63431843-63431865 ATGGATACAACATTACAGCTAGG + Intergenic
1054405190 9:64755835-64755857 ATGGATACAAAATTACAGCTAGG + Intergenic
1054438815 9:65241325-65241347 ATGGATACAAAATTACAGCTAGG + Intergenic
1054491589 9:65780621-65780643 ATGGATACAAAATTACAGCTAGG - Intergenic
1058194596 9:101956948-101956970 ATGGGCAAAAACTTACCCCTAGG + Intergenic
1059404612 9:114092139-114092161 ATGGGCTCCAACATACATCTGGG + Intronic
1059540480 9:115125398-115125420 ATGGATTCAAACACACATCTTGG - Intergenic
1202777649 9_KI270717v1_random:6236-6258 ATGGATACAAAATTACAGCTAGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1186737959 X:12486067-12486089 ATGGGTACCAACTTCCATCTTGG + Intronic
1189621734 X:42847637-42847659 ATGGACAAAAATTTTCAGCTGGG - Intergenic
1190488153 X:50950999-50951021 ATGGATACAAACATACAGGTAGG + Intergenic
1192090096 X:68145253-68145275 ATGAAAACCAGCTTACATCTTGG + Intronic
1193272064 X:79540809-79540831 ATTGCTACAAACTTCCATCTTGG + Intergenic
1193532104 X:82668335-82668357 ATACACACAAACACACATCTTGG + Intergenic
1193873379 X:86829841-86829863 AGGGACACACACTGACATTTGGG - Intronic
1194007039 X:88507504-88507526 ATGAACGCACACTTACATGTAGG + Intergenic
1195384631 X:104302619-104302641 ATGGGCACAATATTACAACTTGG + Intergenic
1198861405 X:141074539-141074561 ATGGATCCAAACTGAAATCTGGG + Intergenic
1198901287 X:141512844-141512866 ATGGATCCAAACTGAAATCTGGG - Intergenic
1199127756 X:144144063-144144085 ATGTACCCAAACTTAAACCTAGG - Intergenic
1201192989 Y:11464521-11464543 ATGGATACAAAATTACAGCTAGG + Intergenic
1202272924 Y:23087934-23087956 ATGGAGACAAATTATCATCTGGG - Intergenic
1202293102 Y:23332748-23332770 ATGGAGACAAATTATCATCTGGG + Intergenic
1202425921 Y:24721678-24721700 ATGGAGACAAATTATCATCTGGG - Intergenic
1202444868 Y:24948408-24948430 ATGGAGACAAATTATCATCTGGG + Intergenic