ID: 945233522

View in Genome Browser
Species Human (GRCh38)
Location 2:207613328-207613350
Sequence CTGTTGTTAAGGAGCTGACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945233522_945233525 -4 Left 945233522 2:207613328-207613350 CCAAGTCAGCTCCTTAACAACAG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 945233525 2:207613347-207613369 ACAGTTTTAGTTTGGATATGAGG 0: 1
1: 0
2: 3
3: 25
4: 255
945233522_945233526 -1 Left 945233522 2:207613328-207613350 CCAAGTCAGCTCCTTAACAACAG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 945233526 2:207613350-207613372 GTTTTAGTTTGGATATGAGGAGG 0: 1
1: 0
2: 1
3: 15
4: 174
945233522_945233527 7 Left 945233522 2:207613328-207613350 CCAAGTCAGCTCCTTAACAACAG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 945233527 2:207613358-207613380 TTGGATATGAGGAGGTAAGTTGG 0: 1
1: 0
2: 1
3: 21
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945233522 Original CRISPR CTGTTGTTAAGGAGCTGACT TGG (reversed) Exonic
900368819 1:2322539-2322561 TTTTTCTAAAGGAGCTGACTCGG - Intronic
902716551 1:18276741-18276763 CTGTTTTTAATTAGATGACTTGG + Intronic
903757475 1:25672658-25672680 CAGTTGCTAATCAGCTGACTTGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
905682099 1:39880907-39880929 CTGTTTTTAAGTAGGTTACTGGG - Intronic
906579870 1:46927543-46927565 CTGTTGGGAAGGAGCTGCTTGGG + Intergenic
906603851 1:47151344-47151366 CTGTTGGGAAGGAGCTGCTTGGG - Intergenic
910279851 1:85487373-85487395 GAGTTATTAAAGAGCTGACTGGG + Intronic
911601441 1:99852297-99852319 CTGCTGCTAACAAGCTGACTTGG + Intronic
918540345 1:185625455-185625477 CTGTTGTTCAGAAGCTTTCTTGG + Intergenic
920081772 1:203380011-203380033 GTGGTGCTAAGGAGCTGGCTAGG - Intergenic
920697720 1:208194264-208194286 CTGCTGTTAATGAGCTGATCTGG + Intronic
923188215 1:231594997-231595019 GTATTTTTGAGGAGCTGACTGGG + Intronic
923520197 1:234729406-234729428 CTGTTCTCAAAGAGCTCACTGGG - Intergenic
923551992 1:234971323-234971345 CTGCTTTTAAAGAGCTGCCTGGG - Intergenic
1066641308 10:37556999-37557021 CCGTTGGTAAGGAGGTAACTGGG - Intergenic
1067711040 10:48651444-48651466 TTGTTGTGCAGGTGCTGACTGGG - Intronic
1068034114 10:51738633-51738655 CTGGTGAGAATGAGCTGACTGGG + Intronic
1072145124 10:92628873-92628895 CTGTTGAGGAGGAGCTGAATAGG + Exonic
1074123767 10:110512293-110512315 CTGTTATTTATCAGCTGACTGGG - Intergenic
1074358614 10:112807340-112807362 CTGAAGTTAAGGAGTTGACAGGG + Intronic
1076505278 10:130968651-130968673 CTGGTGTGAAGGACATGACTGGG - Intergenic
1083447282 11:62716880-62716902 GTATTGTTAATGACCTGACTTGG + Intronic
1084420860 11:69059825-69059847 CTGTTGTCAGGGGGCTGTCTCGG + Intronic
1085125307 11:73997713-73997735 CTGTCCTCAAGGAGCTCACTGGG - Intergenic
1088167962 11:106960843-106960865 CTGTTGTTATCTAGTTGACTTGG - Intronic
1089628861 11:119770871-119770893 CTGCTGTTTGGGAGCTGACCAGG - Intergenic
1089836333 11:121373842-121373864 CAGTAGGTAAGGAGCTGAGTTGG - Intergenic
1091406978 12:215122-215144 CTGTTCTGGAGGAGCTCACTGGG - Intergenic
1092241120 12:6837170-6837192 CTTTTGTGAAGGAGCTTTCTTGG + Intronic
1095429507 12:42117783-42117805 TTGTTGTTAAGGAACTTACAAGG + Intronic
1098077336 12:66746540-66746562 CTGTTGTTAAGGCACTAAGTGGG + Intronic
1099142970 12:79002753-79002775 TTGTTGTTAAGGAGATGAGGAGG + Intronic
1100180017 12:92074832-92074854 GTGTTTTTAAGCAGCTGATTGGG + Intronic
1100822173 12:98441831-98441853 ATGTGCTGAAGGAGCTGACTTGG + Intergenic
1102542231 12:113629629-113629651 CTGTTCTTGAGGAACTGGCTAGG + Intergenic
1103479450 12:121241603-121241625 CTGTTCTTAGGGAGGTCACTGGG + Intronic
1109004313 13:56851759-56851781 ATGTTGATTAGTAGCTGACTAGG - Intergenic
1109220640 13:59637626-59637648 GGGTTGTTAAGGATCAGACTAGG + Intergenic
1109273519 13:60279898-60279920 ATGTTGCTAACGAGCTGATTTGG + Intergenic
1111598033 13:90435682-90435704 CTGTAGGTAAGGAGCTGAATTGG - Intergenic
1112093363 13:96106492-96106514 CTGTCTGTAAAGAGCTGACTGGG - Intronic
1114571567 14:23672802-23672824 CTGATTTTAAGGAGATGAGTGGG - Intergenic
1119977850 14:79045257-79045279 CGATTGTTGAGGAGCTGAATGGG - Intronic
1121014062 14:90537723-90537745 CTGCTGTTTAGAAGGTGACTAGG - Exonic
1121505304 14:94472633-94472655 TTGTTCTTAAGGAGCCCACTGGG + Intronic
1125318266 15:38455096-38455118 CAGTTTTCCAGGAGCTGACTTGG - Intronic
1127392026 15:58513524-58513546 CTGTTTTTAGGGGGCTGGCTTGG - Intronic
1128363131 15:66976662-66976684 CTGCTCTTAGGGAGCTCACTAGG + Intergenic
1129034777 15:72642405-72642427 CTTTTTTTATGGAGCTGACTTGG + Intergenic
1129215105 15:74094811-74094833 CTTTTTTTATGGAGCTGACTTGG - Intergenic
1129390264 15:75216805-75216827 CTTTTTTTATGGAGCTGACTTGG + Intergenic
1129817497 15:78567609-78567631 CAGTTCTTAAGGAGCTTACGTGG - Intronic
1130848028 15:87765719-87765741 CTGTAGTTAAGGTGATGACCAGG - Intergenic
1132306780 15:100820765-100820787 ATGCTGTTGATGAGCTGACTAGG - Intergenic
1135288844 16:21217294-21217316 CTTCTGTTAAGAAGCTGCCTTGG - Intergenic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1136521022 16:30795803-30795825 CTGATGATAAGGACCTGGCTGGG - Intergenic
1136565806 16:31069499-31069521 CTCTTTTTGAGGAGGTGACTGGG - Intronic
1139036279 16:62950504-62950526 CAGTTGTAAAGGAGCTGTTTCGG + Intergenic
1142561194 17:810440-810462 CTGATGTTAACGAGCTAAATAGG - Intronic
1147526027 17:41224437-41224459 CTGTTGTTAGAGAGCTGCATGGG + Intronic
1151869984 17:76830064-76830086 CTGTGGTTAGGGAGTTGGCTGGG + Intergenic
1152782699 17:82233185-82233207 CTGGTGTCCAGGGGCTGACTTGG - Intronic
1153613789 18:6914855-6914877 CCTTTGTTAAGCAGCTCACTTGG + Exonic
1156054895 18:32990058-32990080 CTATTGTTAAAGAGTTGAGTAGG + Intronic
1162496425 19:11025578-11025600 CTGTTTTTAAAGAGCTGTCGAGG - Intronic
929435712 2:41927019-41927041 CTGGTGAAAAAGAGCTGACTTGG - Intergenic
929698423 2:44140491-44140513 CTGTTGTTTAGGAGGGAACTTGG + Intergenic
931086091 2:58832000-58832022 CTCTTGTTTTGGAGTTGACTCGG + Intergenic
937757457 2:125557333-125557355 CTGTTGTTGAGGTGCTGGCCAGG - Intergenic
939729779 2:145768436-145768458 CTTTTGTTAAGGAGGGGAATTGG - Intergenic
945233522 2:207613328-207613350 CTGTTGTTAAGGAGCTGACTTGG - Exonic
945881709 2:215331190-215331212 CTGTCCTTATGGAGCTTACTGGG - Intronic
1170825001 20:19786128-19786150 CTCTTGATAAGGAGGTGCCTAGG - Intergenic
1171163175 20:22947077-22947099 CTGTAACTAAGGAGCTGACTTGG + Intergenic
1171520611 20:25771930-25771952 CTGATGTTCAGTTGCTGACTAGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1175174868 20:57105060-57105082 CTGGTGCTAAGGACTTGACTCGG + Intergenic
1179202221 21:39235652-39235674 CTTTTGTTAAGGAGCCGACTTGG - Intronic
1182083501 22:27545434-27545456 CTGTTATGAAGGAGCTGATGTGG - Intergenic
949704053 3:6795168-6795190 CAGTTGTTAAGTAGCTGAGAAGG + Intronic
957538933 3:81543348-81543370 CTGTTGTAAACGAGCTGACAAGG + Intronic
958193116 3:90208627-90208649 CTGTTGTTAAAGAGCAAACCGGG - Intergenic
961231009 3:125309074-125309096 CTGTTGTGGAGGAATTGACTGGG + Intronic
961953428 3:130774079-130774101 CTGTTATTAAGGAGATAAGTAGG - Intergenic
962355068 3:134686608-134686630 CTGCTGATGTGGAGCTGACTTGG - Intronic
964496277 3:157294113-157294135 CTGATGTTAAAGAGCTAATTTGG + Intronic
966977604 3:185099229-185099251 CTCTTGTGAAGTAGCTTACTGGG - Intronic
967570772 3:191025941-191025963 ATGTTGTTTATGAGCTGATTGGG + Intergenic
968599164 4:1501060-1501082 CTGTTGTAAAGAACATGACTTGG - Intergenic
969532533 4:7737765-7737787 CTGGTGTCTGGGAGCTGACTGGG + Intronic
977375875 4:96203394-96203416 CTGTTGTTCAGGAAGTGAGTTGG + Intergenic
979174867 4:117651255-117651277 CCATTGTCCAGGAGCTGACTTGG - Intergenic
983789053 4:171772205-171772227 CTTGTGCTAAGGAGATGACTCGG + Intergenic
983792599 4:171815250-171815272 CTGTTGCTAAGGTGCTGCCATGG + Intronic
987079508 5:14413911-14413933 CTTATGTTAACTAGCTGACTGGG - Intronic
988471504 5:31543852-31543874 CTGGTGATGAGGAGCTAACTGGG - Intronic
990889137 5:60630294-60630316 CTCTGGGCAAGGAGCTGACTCGG - Intronic
991296109 5:65083382-65083404 CTGATGGTAGGGAGCTGAATGGG - Intergenic
991965061 5:72082437-72082459 CAAGGGTTAAGGAGCTGACTTGG + Intergenic
995558281 5:113353349-113353371 CTGTTGCTAAGGACATGGCTGGG - Intronic
995882082 5:116854313-116854335 CTGTTGATGGGGAGCTGTCTTGG - Intergenic
996803755 5:127431672-127431694 CTGTTGTTAAGCAGGAGTCTTGG + Intronic
1002892830 6:1351460-1351482 CTGTTTTTAAGATGCTGTCTTGG - Intergenic
1004202583 6:13563220-13563242 CTGTGGTTAAGGCGCTGAGCTGG + Intergenic
1005799311 6:29404245-29404267 ATGTTGCTAAGGTGCTTACTAGG - Intronic
1010736087 6:79444851-79444873 CTGTAGTTCAGGGGCTGGCTGGG + Intergenic
1011352577 6:86438738-86438760 CTGTTTTTAAAAAGCTGACCAGG - Intergenic
1011614404 6:89184652-89184674 CTGCTGTCAAGGAGGGGACTCGG + Intronic
1019254975 7:43834-43856 CTGTTGTAAAGGAGCAGACAGGG + Intergenic
1019634873 7:2070175-2070197 CTGTCCTTCAGGAGCTGACTTGG + Intronic
1022640229 7:32175120-32175142 CTGTGGTTGAAGAGATGACTAGG + Intronic
1023224125 7:37951355-37951377 CTCTTGTGAATGAGCTGACCTGG - Exonic
1027178396 7:75919829-75919851 CACTTGTTAAAGAGGTGACTTGG + Intronic
1028452948 7:91005942-91005964 CTGTGGTTTAAGATCTGACTCGG + Intronic
1029920371 7:104256181-104256203 CTGTCATTAATCAGCTGACTTGG + Intergenic
1030820872 7:114088455-114088477 CTGTTGTCAAGCAGCTGAAGTGG + Intronic
1036542342 8:9729221-9729243 ATAGTGTTAAGGAGGTGACTGGG - Intronic
1036599853 8:10250568-10250590 CTGTTGATAAGGAAATGTCTGGG - Intronic
1040632666 8:49234164-49234186 CTGTTCTTAAGAAGCTGTCAAGG - Intergenic
1045057429 8:98381747-98381769 CAGTTGTTAAGCAGCAGAATAGG + Intergenic
1051612059 9:18970826-18970848 CTGTTGCTAAGCAGCTTCCTAGG + Intronic
1054976031 9:71146555-71146577 CTGTTATTAAGGTGCTCCCTGGG - Intronic
1059656140 9:116359484-116359506 GTGTTGTCAGGGAACTGACTGGG - Intronic
1061156331 9:128863970-128863992 GGGCTGTTGAGGAGCTGACTAGG - Intronic
1186307104 X:8273605-8273627 CTGTAGATATGGGGCTGACTAGG - Intergenic
1186665646 X:11714185-11714207 CTGTTGTTCAGGAGGAGAGTTGG + Intergenic
1198717755 X:139578866-139578888 CTTGTGTTATGGAACTGACTAGG + Intergenic
1198735737 X:139783232-139783254 CTTTTGTAAAGGAGCAGACTCGG - Exonic
1199807496 X:151314823-151314845 CTGTTGTTCAGGGACTGAGTAGG + Intergenic