ID: 945233660

View in Genome Browser
Species Human (GRCh38)
Location 2:207614515-207614537
Sequence CAGCCTAAGGAGAAGTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945233660 Original CRISPR CAGCCTAAGGAGAAGTGGAC TGG (reversed) Intronic
903193703 1:21669936-21669958 CAGGCTACGGAGAAGTGGAAGGG + Intergenic
903222182 1:21875124-21875146 CAGCCTCTGGAGATCTGGACAGG - Intronic
904371206 1:30048556-30048578 CAGCTCAGGGAGAGGTGGACAGG - Intergenic
906124564 1:43419826-43419848 CCGGCTCAGGACAAGTGGACAGG - Exonic
906685389 1:47760060-47760082 CTGCCGAAGGAAGAGTGGACTGG + Intergenic
906748637 1:48239398-48239420 CAGCCTGTGGGGAGGTGGACCGG + Exonic
910116273 1:83735806-83735828 CAGCCTAAGGAGAGGCCCACAGG - Intergenic
910982723 1:92974934-92974956 TTGCCTAAGGAGGAGTGAACTGG - Intergenic
911336175 1:96583394-96583416 TTGCCTAAGGAGAGGTGAACAGG + Intergenic
912053769 1:105568609-105568631 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
913441512 1:118903171-118903193 AAGCCTAAAGAGAAGAGGCCTGG - Intronic
914448174 1:147768009-147768031 CAGCCTCAGGAGAAATGATCAGG + Intronic
916521981 1:165571700-165571722 CAGCCTAAGGAGATTTTCACTGG - Intergenic
919538339 1:198816245-198816267 TAGGCTAAGGAGAAGTAGAAAGG - Intergenic
919706325 1:200679639-200679661 CACCCAATGGAGAAGTGGAAAGG - Intergenic
920427432 1:205889320-205889342 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
920907911 1:210188931-210188953 CAGCCTAGGGAGGAGGGGAGAGG - Intergenic
923111509 1:230894292-230894314 CAGGCTAAGGAGGGGTGCACTGG + Intergenic
1063857885 10:10275075-10275097 CAGGGTCTGGAGAAGTGGACAGG - Intergenic
1066103492 10:32137741-32137763 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1066450252 10:35522036-35522058 AAGTCTAAGGAGAATTGTACTGG - Intronic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067525481 10:47035940-47035962 GAGCCTAAGGACAAGTGGGCAGG - Intergenic
1067547572 10:47205416-47205438 CAGTCTAAGCATAAGTGGCCAGG + Intergenic
1069147717 10:64916974-64916996 CACCCTGAGCAGAAGTGGCCTGG + Intergenic
1069466194 10:68641413-68641435 TTGCCTAAGGAGATGTGAACTGG - Intronic
1070478986 10:76862567-76862589 CAGACAAAGCAAAAGTGGACTGG + Intergenic
1070657407 10:78280956-78280978 CTGCCTGAGGAGGAGTGGCCTGG + Intergenic
1070874249 10:79787461-79787483 CAGCTGAAGGAGAATTAGACTGG + Intergenic
1071305356 10:84294687-84294709 CAGCCCAAACAGAAGGGGACAGG + Intergenic
1071550887 10:86565326-86565348 CAGCCTGGGGAGAAGGGGAAAGG + Intergenic
1076642744 10:131929800-131929822 CAGACTAAGGAGCTGTGGATGGG - Intronic
1078598181 11:12707272-12707294 CAGCATGAGGAGGAGTGGAAGGG - Intronic
1082094730 11:48120263-48120285 CAGCGTAAAGAGAAAAGGACTGG - Intronic
1083227405 11:61293960-61293982 CAGCCTGAGAAGGAGGGGACCGG + Intronic
1084215548 11:67645256-67645278 CAGCCTTCTGAGAAGTGGGCGGG - Intronic
1084270052 11:68024111-68024133 CAGCTTAAGGAGTGCTGGACAGG + Intronic
1084307820 11:68298361-68298383 CGGCCTCGGGAGCAGTGGACAGG - Intergenic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1087698063 11:101403540-101403562 CAGCCTAAGGAGGAGGGGACAGG + Intergenic
1089953166 11:122548219-122548241 CAGCCTAGGGAGGAGGGGAAAGG - Intergenic
1090366696 11:126212196-126212218 CATCCTTAGGAGAAGGGTACAGG - Intronic
1093257783 12:16892626-16892648 GAGACTCAGGAGAAGTGGAATGG - Intergenic
1094018887 12:25893350-25893372 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1094129210 12:27056645-27056667 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1095357747 12:41296327-41296349 CAGCCAAAGCAAAAGTAGACAGG + Intronic
1100693870 12:97068843-97068865 CAGTCCAAGCAAAAGTGGACTGG - Intergenic
1101899687 12:108782217-108782239 CTGCCTGGGGTGAAGTGGACTGG + Intergenic
1105402097 13:20105045-20105067 CAGACAAGGGAGAAGTGCACGGG + Intergenic
1107515179 13:41122041-41122063 TTGCCTAAGGAGGAGTGAACTGG + Intergenic
1107698294 13:43022184-43022206 CAGTATAAAGAGAACTGGACTGG - Intergenic
1108247625 13:48533221-48533243 CAGCCTAGGGAGGAGAGGAGGGG - Exonic
1109489141 13:63072234-63072256 CAGTCAAAGAAAAAGTGGACTGG - Intergenic
1110961705 13:81634425-81634447 CAAGCAAAGGAGAAATGGACAGG - Intergenic
1111648387 13:91060702-91060724 GAGCCTAAGGAGTAGCGGAGAGG - Intergenic
1112638515 13:101245073-101245095 CAGCCTGTGGAAAAGTGGAACGG + Intronic
1114367878 14:22049578-22049600 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1115823104 14:37233911-37233933 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1116690997 14:48105621-48105643 CAGCCCAAGGTGGAGTGCACCGG + Intergenic
1116774076 14:49159593-49159615 CAGACTAAGGAGAAGAGAAGGGG + Intergenic
1117933837 14:60878698-60878720 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1119196592 14:72721634-72721656 CACCCAAAGCAGAACTGGACAGG + Intronic
1119248496 14:73132722-73132744 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1120281493 14:82444105-82444127 CAGCCTAGGGACAAGTGGAAAGG + Intergenic
1120660051 14:87239077-87239099 CAGCCTGAGGAGGAGGGGAGAGG + Intergenic
1121171642 14:91859450-91859472 AAGCTTCAGGAGAAGTGGAATGG - Intronic
1121884396 14:97529994-97530016 TTGCCTAAGGAGGAGTGAACTGG - Intergenic
1125478578 15:40064206-40064228 CAACCCAATGAGAAGAGGACTGG - Intergenic
1125848994 15:42886175-42886197 CAGCCTGGGGAGAAGGGGAGAGG - Intronic
1125954343 15:43778860-43778882 CAGCCTAAGCTGGAGTGGAGTGG - Intronic
1128545298 15:68562329-68562351 CAGTCTCAGGAGAAGAGGAAGGG - Intergenic
1128614887 15:69101269-69101291 CAACCTAACTAGAAGTGGAGGGG - Intergenic
1129462518 15:75706701-75706723 CAGCTTGAGTAGAAGTGGAAAGG + Intronic
1129722345 15:77884713-77884735 CAGCTTGAGCAGAAGTGGAAGGG - Intergenic
1131618808 15:94045281-94045303 CAGCCACAGCAGAAGTGGACCGG - Intergenic
1133722078 16:8504105-8504127 CAGTCAAAGTAAAAGTGGACTGG - Intergenic
1133929642 16:10221886-10221908 TTGCCTAAGGAGAGGTGAACTGG - Intergenic
1135025507 16:18996201-18996223 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
1135207833 16:20498021-20498043 CATCCAAAGGAGAAGTAAACAGG + Intergenic
1135211066 16:20525679-20525701 CATCCAAAGGAGAAGTAAACAGG - Intergenic
1136684956 16:31988638-31988660 CAGCGTGAGGAGAGGTGGAAGGG + Intergenic
1136884201 16:33921631-33921653 CAGCGTGAGGAGAGGTGGAAGGG - Intergenic
1137905757 16:52320330-52320352 CAGCCAATGGACCAGTGGACTGG - Intergenic
1138691234 16:58770687-58770709 CTGCCTAAGGAGGGGTGAACTGG + Intergenic
1139114371 16:63931665-63931687 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143414488 17:6736021-6736043 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1143742151 17:8962264-8962286 TAGCCAAAGGAGAAAAGGACAGG + Intronic
1144848238 17:18231089-18231111 GAGCCTGAGGACAAGTGCACTGG - Intronic
1146768773 17:35548909-35548931 CATCCAAAGGCGAAGGGGACTGG - Exonic
1146945606 17:36871000-36871022 GAGCCTATGGAGAAGTGGGTGGG - Intergenic
1148003892 17:44409170-44409192 TTTCCTAAGGAGAAGTGAACTGG - Intronic
1148688470 17:49513512-49513534 CAGCCTAAGATGAAGAGGATCGG + Exonic
1151622397 17:75254208-75254230 CAGCCTGAGGAGAAGGGGAAAGG - Intronic
1153735764 18:8065477-8065499 CTCCCTATGGAGAAGTGCACTGG - Intronic
1154940280 18:21106161-21106183 CAGCCAGAAGAGAAGTGGAAAGG + Intronic
1155006346 18:21733011-21733033 CAGTCAAAGCAAAAGTGGACCGG - Intronic
1155389842 18:25323468-25323490 CAGCCCAAGCAGAAGTGCAGTGG + Intronic
1155961851 18:32001904-32001926 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1156136068 18:34039614-34039636 CAGGCTAAAGAAAAGTGGAATGG - Intronic
1156255280 18:35389473-35389495 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1156270370 18:35525039-35525061 CAGGCCAAGGAGAAGAGGAGAGG - Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1163732549 19:18958067-18958089 TTGCCTAAGGAGAGGTGAACCGG - Intergenic
1164193639 19:22934169-22934191 CAGCCTAAGCAGGATTGGAGAGG - Intergenic
1166809029 19:45504660-45504682 CAACTTAAGGAGGTGTGGACTGG - Intergenic
1167786838 19:51644247-51644269 CACATTAAGGAGAAGTGGATGGG + Intronic
926079242 2:9970653-9970675 CAGCCTGTGGAGAAGGGGAAGGG + Intronic
926693411 2:15753585-15753607 CATCCTCAGAAGAAGTGAACTGG + Intergenic
926704426 2:15826615-15826637 CAGCCCAGGGAGAGGTGGACAGG + Intergenic
926993825 2:18711825-18711847 TAGTCCAAGGAAAAGTGGACTGG - Intergenic
927057749 2:19382679-19382701 CAGTCAAAGTAAAAGTGGACTGG - Intergenic
929684632 2:44023119-44023141 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
931129145 2:59313779-59313801 CAGCTTACCGACAAGTGGACAGG + Intergenic
933266446 2:80185810-80185832 CAGCTTCAGGATAAGTGCACTGG - Intronic
934555219 2:95283483-95283505 CAGCTTCAGGAGAAGTGGAAAGG - Intronic
936374675 2:111930333-111930355 TTGCCTAAGGAGGAGTGAACTGG + Intronic
936870699 2:117131942-117131964 CAGCCTAAGAAGGAGGGGAGAGG - Intergenic
936976409 2:118225702-118225724 CAACCTAAGGAGGAGTGAAAAGG + Intergenic
937219604 2:120334674-120334696 GAGCTTAAGGAGAAGCAGACTGG - Intergenic
937466502 2:122137557-122137579 CAGCCTAAGGAGACTAAGACAGG + Intergenic
937641553 2:124217595-124217617 CAGGATAAGGTGAAGTGGAGGGG - Intronic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
941620025 2:167766917-167766939 CAGGCAAAGAAAAAGTGGACTGG - Intergenic
943249754 2:185503747-185503769 CAGTCAAAGTATAAGTGGACTGG - Intergenic
943636030 2:190307932-190307954 CAGAGTTATGAGAAGTGGACAGG - Intronic
944481947 2:200166118-200166140 CAGCTCAAGGTGCAGTGGACAGG + Intergenic
945233660 2:207614515-207614537 CAGCCTAAGGAGAAGTGGACTGG - Intronic
945233785 2:207615854-207615876 CAGCCTAAGGAGAGGTGGACTGG + Intronic
945858024 2:215091212-215091234 CAGCCTGGGGAGGAGTGGAGAGG - Intronic
947789615 2:232857050-232857072 CAGACTATAGATAAGTGGACTGG + Exonic
949003977 2:241634978-241635000 GAGCCTAGGGAGAGGAGGACTGG + Intronic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1170785045 20:19460418-19460440 CAGCCTAACCAGATGTGGGCAGG + Intronic
1170927469 20:20738544-20738566 TTGCCTAAGGAGGAGTGAACTGG - Intergenic
1172468061 20:35171869-35171891 CAGCCCAAGGAGAAGGGAAAAGG + Intergenic
1172933166 20:38600529-38600551 GAGGCTCAGGAGAAGTGGATGGG + Intergenic
1173624350 20:44461170-44461192 TTGCCTAAGGAGAGGTGAACTGG + Intronic
1173730527 20:45325385-45325407 CAGCCCAAGGGGAAGGGCACTGG + Exonic
1174340278 20:49891063-49891085 CATCCTCAGCAGAAGTGGCCTGG - Exonic
1175700625 20:61134350-61134372 CAGCACAAGGAGATGTGGAATGG + Intergenic
1176413199 21:6459827-6459849 CCTGCTAAGGAGCAGTGGACGGG - Intergenic
1177506261 21:22022172-22022194 AAGCCATAGGAGAAATGGACTGG + Intergenic
1179281742 21:39939616-39939638 CAGCACCAGGAGAATTGGACAGG - Intergenic
1179688695 21:43068149-43068171 CCTGCTAAGGAGCAGTGGACGGG - Intronic
1180024313 21:45150661-45150683 CACCCTAACGAGAAGTGAAGGGG + Intronic
1181464920 22:23105840-23105862 CAGCTGAAACAGAAGTGGACTGG + Intronic
1181490637 22:23258886-23258908 CAACCAGTGGAGAAGTGGACGGG + Intronic
1181590219 22:23879604-23879626 CTGCCTAAGGAGGAATGCACTGG - Intronic
1183635770 22:39061574-39061596 CAGCCTGAGGAGAAGAGGAGAGG + Intronic
1184048825 22:41989470-41989492 CACCCACAGGAGAAGAGGACTGG - Intronic
950643658 3:14364356-14364378 CAGCCTCAGGGAATGTGGACTGG - Intergenic
950862921 3:16166067-16166089 CAGCCTATGGAGGGGTGGAAAGG + Intergenic
951162533 3:19442126-19442148 CAGCCTAGGGAGCAGAGAACAGG + Intronic
951570970 3:24062880-24062902 CTGCCTAAGCAGAAGTTGAAAGG + Intergenic
952895348 3:38075093-38075115 CAGCCTGAGGAGGAGGGGAAAGG + Intronic
953852126 3:46472317-46472339 GAGGCTAAGGATGAGTGGACAGG - Intronic
955784452 3:62522174-62522196 CAGCCTAAGGTGGAGTGCAGTGG + Intronic
957343894 3:78938110-78938132 TGGCCTAAGGAGGAGTGAACAGG - Intronic
958497597 3:94864508-94864530 CAGCCTGAGGGGAAGTGGAGAGG + Intergenic
960399463 3:117178600-117178622 CTGCCTAAGGTGAAGGGGACAGG + Intergenic
960573220 3:119205675-119205697 CAGGCCAAGGAGAGGTGAACTGG - Intergenic
960667251 3:120122074-120122096 TTGCCTAAGGAGGAGTGAACTGG + Intergenic
961712866 3:128840616-128840638 CAGCCCAGGGAGAAGGGGAGAGG + Intergenic
962962396 3:140322516-140322538 CATCCCAAGGATAAGTGGTCAGG + Intronic
964032941 3:152160402-152160424 CAGCCTAAGCAGGAGTGGAGAGG - Intergenic
964067735 3:152598651-152598673 CAGCCTGAGGAGGAGGGGAGAGG - Intergenic
964941054 3:162158231-162158253 CAGCCTAGGGAGGAGGGGAGAGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965862069 3:173159995-173160017 CAGCCTAGAGAGAAGGGGAGAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967005465 3:185378605-185378627 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
967595488 3:191323060-191323082 CAGTCTTAGGAGAAGTTGATGGG + Intronic
968413415 4:407930-407952 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
971286461 4:25294763-25294785 CAGCCCAAGTAGAAGGGGAGTGG - Intergenic
971742220 4:30535260-30535282 GGGCCTAAGGAGAAGTGTTCAGG + Intergenic
971860292 4:32093127-32093149 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
973875631 4:55215735-55215757 TTGCCTAAGGAGAGGTGAACCGG - Intergenic
976841963 4:89442205-89442227 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
977451693 4:97206995-97207017 TAGCCTAAGGAGGAGTGGGAGGG + Intronic
977732978 4:100377773-100377795 CAGCCAAAGCAAAAGTGAACTGG + Intergenic
978303329 4:107294513-107294535 CAGCCTGGGGAGGAGTGGAGAGG + Intergenic
979559620 4:122087633-122087655 TTGCCTAAGGAGGAGTGAACTGG - Intergenic
982318709 4:154057912-154057934 CAGCCTGAGGAGGAGGGGAGAGG - Intergenic
983170778 4:164534125-164534147 CAGCCAAGGTAGAAGTGGAGAGG + Intergenic
985518879 5:361392-361414 TGGCCTAAGGAGAACAGGACGGG + Intronic
992452152 5:76884812-76884834 CAGCCTGGGGAGAAGGGGAGAGG + Intronic
994114801 5:96050177-96050199 CAGTCTGTGGAGGAGTGGACAGG + Intergenic
995125299 5:108572874-108572896 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
996074173 5:119169866-119169888 CAGACTGAGGAGAAGTGTTCAGG + Intronic
996240737 5:121198191-121198213 CAGCATAAAGAGCAGTGAACTGG + Intergenic
997233235 5:132258355-132258377 CACCCTAAGGGGAAGTGACCAGG + Intronic
997585071 5:135039208-135039230 CACCCCCAGGAGAAGTGGGCAGG - Intronic
999307120 5:150526852-150526874 GAGCCTAAGGAAGAGGGGACTGG + Intronic
1000560597 5:162783616-162783638 TTGCCTAAGGAGAGGTGAACTGG + Intergenic
1000731511 5:164839733-164839755 CAGCCCAGGAAGAAGTGGTCAGG - Intergenic
1001233035 5:170006170-170006192 CAGTCTGAGGGGATGTGGACAGG + Intronic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1004553845 6:16675938-16675960 CTGCCAAAGGAGAAGCGGACAGG + Intronic
1004640027 6:17506277-17506299 TAGCCATAGGCGAAGTGGACTGG + Intronic
1005361051 6:25031108-25031130 TTGCCTAAGGAGAGGTGAACTGG - Intronic
1005589776 6:27311759-27311781 CATCTTCAGGAGAAGTGGAAGGG + Exonic
1007236427 6:40393902-40393924 GAGTCTAAGCAGAAGAGGACTGG + Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1013379084 6:109548910-109548932 CAGTCAAAGCAAAAGTGGACTGG + Intronic
1014115449 6:117663774-117663796 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1014546888 6:122745423-122745445 TTGCCTAAGGAGGGGTGGACCGG + Intergenic
1016717107 6:147247271-147247293 CAGCTTAATGAAAAGTGTACAGG + Intronic
1017648159 6:156557674-156557696 CTGCCTAAGGAGGCGTGGCCAGG + Intergenic
1018463712 6:164023119-164023141 CAGCCTAATGATTAGTGGAATGG - Intergenic
1018813475 6:167314449-167314471 CAGCCTGAGGCGAAGTAGGCAGG - Intronic
1020275694 7:6623174-6623196 CCGCCAAAAGAGAAGTGGACCGG + Exonic
1021440023 7:20667483-20667505 CAGTCTAAGGAGAATTTGAGAGG - Intronic
1022289126 7:28984367-28984389 TAGCCCCAGGAGAAGTGGAAGGG - Intergenic
1022638534 7:32160070-32160092 CAGCCACAGGAGGAGTGGAAAGG + Intronic
1022728023 7:32998307-32998329 CAGCCTCAGGATCAGCGGACAGG - Intronic
1022844053 7:34192154-34192176 CAGCCCAGTGAGAACTGGACTGG + Intergenic
1022859959 7:34357634-34357656 CAGCCTGATGAGGAGTGGGCTGG - Intergenic
1022932263 7:35131082-35131104 CTGCCTAAGGACAGGTGGCCTGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023547775 7:41337225-41337247 CAGCCAAATGAGAAGTCGTCTGG - Intergenic
1025045630 7:55689712-55689734 CAGCCTCAGGATCAGCGGACAGG + Intergenic
1026429132 7:70326296-70326318 CTGCCTTGGGAGAAGTGGAGAGG - Intronic
1027607511 7:80318417-80318439 TTGCCTAAGGAGAGGTGAACTGG + Intergenic
1029087666 7:98023849-98023871 TTGCCTAAGGAGAGGTGAACCGG + Intergenic
1029642378 7:101829225-101829247 CAGCAAAAGGAGTAGTGGAGAGG + Intronic
1031372786 7:120988010-120988032 CAGCCTCAGCAAAAGTGGAAGGG + Intergenic
1031685755 7:124730685-124730707 CAGCCTGAGGAGGAGGGGAAAGG - Intergenic
1031769362 7:125823721-125823743 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1032065012 7:128761468-128761490 TTGCCTAAGGAGGAGTGAACCGG + Intronic
1033084613 7:138330651-138330673 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1038315589 8:26481924-26481946 CAGCCTCAGGAGAAGGCGATGGG - Intronic
1040909767 8:52506011-52506033 CAGCTTGAGGAGTAGTGGCCAGG - Intergenic
1041917644 8:63152392-63152414 CAGCCTGGGGAGAAGGGGAGAGG + Intergenic
1042599090 8:70480303-70480325 TTGCCTAAGGAGAGGTGAACTGG - Intergenic
1042616406 8:70654689-70654711 TTGCCTAAGGAGAGGTGAACTGG - Intronic
1045600384 8:103708219-103708241 TAGCCTGTGGTGAAGTGGACCGG + Intronic
1047738249 8:127785282-127785304 CAGCCTAAAAAGACTTGGACAGG - Intergenic
1049986130 9:953615-953637 CAGCTTAAGCAGCAGTGGAGAGG - Intronic
1050765127 9:9123344-9123366 ATGCCTAAGGAGAACTGGAAAGG - Intronic
1054914652 9:70484750-70484772 CAGCCTGAGGATCAGTGGAGAGG + Intergenic
1059776782 9:117484123-117484145 CATCCTAATTAGAAGTGGGCGGG + Intergenic
1061889679 9:133611601-133611623 CAGCATGGGGAGAAGTGGAAGGG - Intergenic
1186447079 X:9640254-9640276 CAGCCTAGGGAGAAAGGGAAAGG - Exonic
1186456976 X:9717393-9717415 CAGCCTCAGGAAAGGTGGTCAGG + Exonic
1186639502 X:11440511-11440533 CAGGCAAAGGAGAAATGGAAGGG - Intronic
1187103870 X:16220883-16220905 CAGCTTGAGGAGAAGGGGAGAGG + Intergenic
1187134967 X:16539248-16539270 TTGCCTAAGGAGAAGTGAACTGG - Intergenic
1189303520 X:39969804-39969826 CAGCCTAGAGAGAAGGGGAAAGG + Intergenic
1190381763 X:49845958-49845980 CAGCCTATGGAGATGTGGGATGG - Intergenic
1192232729 X:69277275-69277297 CAGTGTAAGGAGAAGAGGAGAGG + Intergenic
1192936002 X:75859054-75859076 CAGGCTAAGGGGAAGGGGAATGG + Intergenic
1193536957 X:82728174-82728196 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1193549919 X:82879247-82879269 CACCCTATGGAGAAGTGGCCAGG + Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194220764 X:91187447-91187469 CAGTCAAAGCAAAAGTGGACAGG + Intergenic
1197089905 X:122523831-122523853 CAGCCCTGGGAGAAGTGGTCAGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1198965823 X:142228168-142228190 CAGCCTGGGGAGAAGGGGAGAGG - Intergenic
1200007075 X:153093909-153093931 TAGCCTGAGGAGAAGTGGAGAGG + Intergenic
1200759189 Y:7021430-7021452 CAGCCTAGGGAGAAAGGGAAAGG - Exonic