ID: 945234396

View in Genome Browser
Species Human (GRCh38)
Location 2:207621415-207621437
Sequence GGGTTAAATCAGATAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945234391_945234396 20 Left 945234391 2:207621372-207621394 CCTCAGCAATGAAGAAAAGACTA 0: 1
1: 0
2: 1
3: 29
4: 287
Right 945234396 2:207621415-207621437 GGGTTAAATCAGATAGTGTATGG 0: 1
1: 0
2: 3
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945234396 Original CRISPR GGGTTAAATCAGATAGTGTA TGG Intronic
904803862 1:33117557-33117579 AGGATAAATGAGTTAGTGTATGG - Intronic
905290448 1:36918235-36918257 GGATTAAATGAGATAATGAAGGG - Intronic
905444331 1:38015558-38015580 GGATTAAATGAAATTGTGTAAGG + Intronic
909537775 1:76757612-76757634 GGATTAAATGAGAAAATGTACGG + Intergenic
911285038 1:95980149-95980171 TATTCAAATCAGATAGTGTAAGG + Intergenic
912716154 1:111985047-111985069 GGGTTAAATGAGATAATCCATGG - Intronic
912863295 1:113234325-113234347 GGATTGAATGAGATAGGGTAGGG - Intergenic
912911496 1:113764082-113764104 GGGTTTAATCACAAAGTGTGTGG - Exonic
913682862 1:121203374-121203396 AGGTTAAATGAGATAAAGTATGG - Intronic
914034703 1:143990999-143991021 AGGTTAAATGAGATAAAGTATGG - Intergenic
914154749 1:145076969-145076991 AGGTTAAATGAGATAAAGTATGG + Intronic
916527482 1:165624950-165624972 GGGGTAAATAAAATAGTGTGGGG + Intergenic
917343664 1:174006380-174006402 AGGTTAAATGAGATAGTGATTGG - Intronic
920253716 1:204639752-204639774 GGATTAAAAGAGATAGTGAATGG - Intronic
920391794 1:205609066-205609088 TGGTTAAATCACTTGGTGTATGG + Exonic
920470172 1:206221887-206221909 AGGTTAAATGAGATAAAGTATGG - Intronic
920683078 1:208087857-208087879 GGGTTTAATCAGATACAATAAGG + Intronic
921548179 1:216498919-216498941 GGATTAAATTAGATAATTTAGGG - Intergenic
924835369 1:247641639-247641661 GTGTTAAATGAGATAATGTATGG - Intergenic
1063504809 10:6587350-6587372 GGGTTAAATAAGATAGTATTTGG - Intergenic
1063805689 10:9637464-9637486 TTGTTAAATCAGAAATTGTATGG - Intergenic
1063936507 10:11083839-11083861 GAATTAGATCAGAAAGTGTACGG + Intronic
1064266765 10:13831636-13831658 GAGTTAAATAAGATGGTGTATGG + Intronic
1065070442 10:22018742-22018764 GGGTTATTTCATATACTGTAAGG - Intergenic
1065406793 10:25376088-25376110 GGTATAAATCTAATAGTGTATGG - Intronic
1065664993 10:28049590-28049612 GGATTAAATGAGATCATGTATGG + Intergenic
1067164913 10:43857525-43857547 GGATTAAATTAGTTAATGTAGGG + Intergenic
1067729159 10:48796725-48796747 GGGTTAAGCCAGATAGTATCTGG + Intronic
1068385987 10:56328041-56328063 TGGTTAGAGCAGAAAGTGTAAGG - Intergenic
1068502790 10:57861433-57861455 GTATTAAATAAGATATTGTATGG - Intergenic
1071668690 10:87586829-87586851 TGATTAAATCAGAAAATGTATGG - Intergenic
1071730422 10:88243108-88243130 GGATTAAATCATATAATGTGTGG + Intergenic
1072328636 10:94323482-94323504 TGGTGAAATCAGATATGGTAGGG - Intronic
1072633321 10:97161949-97161971 GGATTAAATGAGATAATATAAGG + Intronic
1073314500 10:102569469-102569491 GGGTGAACTCAGGTAGTGCAGGG - Intronic
1073721026 10:106171834-106171856 AGATTAAATGAGATACTGTATGG - Intergenic
1078423817 11:11233568-11233590 AGGGTAAATGAGATAGTGTGAGG + Intergenic
1079354979 11:19723238-19723260 GGATTAAATGAGATTATGTAAGG - Intronic
1079356957 11:19737701-19737723 GGGTTAAGTGAAATAGTGCATGG + Intronic
1080078124 11:28176522-28176544 GGGTTAAATCAGTTAATATTAGG + Intronic
1084791781 11:71479635-71479657 GGATGAAATCACACAGTGTATGG + Intronic
1085281422 11:75333602-75333624 GGCTTAAATGAGATAATGCATGG - Intronic
1085964690 11:81508673-81508695 GGGTTGAAAAAGAAAGTGTAAGG - Intergenic
1086240039 11:84678917-84678939 GTGTTAAACAAGATAATGTATGG + Intronic
1089130786 11:116210268-116210290 GGATTAAATGAGATAATATATGG - Intergenic
1090538508 11:127674169-127674191 TGGTTCAATCAGATAATATATGG - Intergenic
1095524400 12:43108234-43108256 GGGCTAAATGAGATAGTTTATGG + Intergenic
1095546307 12:43374671-43374693 AGGTCAAATGAGATAATGTATGG + Intronic
1096765605 12:53886349-53886371 GGGTTAAAGCCGATAGTATTTGG - Intergenic
1098336188 12:69407312-69407334 GGACTAAATGAGAAAGTGTATGG + Intergenic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1098935191 12:76471213-76471235 GGATTAAATGAGAAACTGTATGG + Intronic
1101138288 12:101768856-101768878 GGCTTAAATCAGATAGGATAGGG - Intronic
1102558398 12:113744518-113744540 GGATTAAAAGAGATAATGTAGGG + Intergenic
1102800810 12:115731961-115731983 GGATCAAACCAGATAGTATATGG - Intergenic
1102809535 12:115812494-115812516 GGCTTAGAAAAGATAGTGTAAGG - Intergenic
1103141577 12:118553347-118553369 GGATTAAATGAGATAATGTAGGG - Intergenic
1105276928 13:18938969-18938991 AGGTTAAATAAGATAATGTTTGG + Intergenic
1105620712 13:22063391-22063413 GGTCTAAATGAGATACTGTATGG - Intergenic
1106359155 13:29014041-29014063 GGCTTAAAACACACAGTGTAAGG - Intronic
1106789617 13:33141370-33141392 GGATTAAATGAGATAATGTGTGG + Intronic
1108044435 13:46369974-46369996 TGGTTGAAACAGATACTGTATGG - Intronic
1108317720 13:49254076-49254098 GGATTAAATGAGATAATTTAGGG + Intronic
1109785838 13:67173352-67173374 GTATTAAATCAGAAAATGTAGGG + Intronic
1112764766 13:102729175-102729197 GGGATACATCAGATATGGTAAGG - Intergenic
1112992645 13:105532872-105532894 GGGATAAATAAGATTGTTTAGGG + Intergenic
1113193597 13:107778906-107778928 GGGAAAAATCTGATAGTTTATGG - Intronic
1113580613 13:111426096-111426118 TGGTTAAATGAGACAGTGTGTGG - Intergenic
1115206216 14:30908375-30908397 GTATTAAATTTGATAGTGTAGGG - Intronic
1116753760 14:48920050-48920072 GGGTGAAATCAGTGAGTGAATGG + Intergenic
1116874848 14:50100776-50100798 TGGTTAAACTAGATAATGTATGG - Intergenic
1121069692 14:91006652-91006674 TGTTTAAACCAGATAGTTTATGG + Intronic
1122057865 14:99117133-99117155 GGATTAAATGAGATAGTGCATGG - Intergenic
1124201161 15:27679538-27679560 TGATTTAATAAGATAGTGTAAGG - Intergenic
1125226150 15:37398580-37398602 GGACTAAATGAGACAGTGTATGG - Intergenic
1125419841 15:39494069-39494091 GAATTAAATCAGATAATATACGG + Intergenic
1125499694 15:40231865-40231887 GGATTAAATGAGTTAGTGTATGG + Intergenic
1130963385 15:88679901-88679923 GGATTAAATGAGATGATGTATGG + Intergenic
1133546819 16:6815557-6815579 GGATTAAATGAGATACTGTATGG - Intronic
1133858578 16:9573080-9573102 GGATTAAATGAGATCGTGCATGG - Intergenic
1134392210 16:13830506-13830528 GGGATAAATAAGCTAATGTATGG - Intergenic
1137321914 16:47392705-47392727 GGGTGAAATGAAATAATGTATGG + Intronic
1138580212 16:57936068-57936090 GGGTTAAGTCAGAAAGTGACAGG + Intronic
1140443058 16:75001148-75001170 GGGAAAATTTAGATAGTGTAGGG + Intronic
1144132325 17:12258611-12258633 TGGTTGAATGAGACAGTGTATGG - Intergenic
1144429542 17:15178649-15178671 TGTTTAAATTATATAGTGTAGGG - Intergenic
1144741464 17:17584904-17584926 GGATTAAATGAGAAAGTGCAAGG + Intronic
1146726869 17:35163579-35163601 GGGCTCAATGAGATAATGTATGG - Intronic
1148701525 17:49589888-49589910 AAGCTAAATAAGATAGTGTAGGG + Intergenic
1149549421 17:57529082-57529104 AGTTTAAATCATATAGTATATGG - Intronic
1151473658 17:74332964-74332986 GGATTAAAGGAGATAATGTAAGG + Intronic
1153559794 18:6360659-6360681 GCATCAAATCAGATAATGTATGG - Intronic
1156190069 18:34708839-34708861 GGATTAAATGAGATAGTCCAAGG - Intronic
1157350097 18:46876328-46876350 GTGCAAAATCAGATAGTGCAGGG + Intronic
1159264645 18:66064645-66064667 GGGTTAAATCAGGTAATAAATGG + Intergenic
1160775580 19:853594-853616 GGGTTAAATGAGATCCTGCAGGG + Intronic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
926064044 2:9823076-9823098 GGGTTAAATAAGGTGATGTAGGG - Intergenic
928647963 2:33375186-33375208 GGGTTAAATGTGATAATGCATGG + Intronic
930531641 2:52595904-52595926 GGTTTAAATCACTTAGTCTATGG + Intergenic
931577599 2:63735475-63735497 GGGTTGAGTCAGACAGTGCAAGG + Intronic
932417486 2:71582339-71582361 GGGTTAAATGAGATACTATGTGG - Intronic
935966768 2:108485409-108485431 GGGTTAACTAAGATTGTCTATGG + Intronic
937494014 2:122398964-122398986 GGATTAAATAAGATAATTTACGG + Intergenic
937861302 2:126713140-126713162 GGGTTTATTCTGGTAGTGTAAGG + Intergenic
938186276 2:129234737-129234759 CGTTTAAATCAGATGGTGTTTGG - Intergenic
939479934 2:142735070-142735092 GGATTAAATGAGATGATGTAGGG - Intergenic
940191344 2:151043337-151043359 GGTTTAAATCAGATAATGTAAGG + Intronic
941961057 2:171253998-171254020 GGGTTATATCAGACAGTTCAAGG + Intergenic
942195051 2:173508808-173508830 GATTTAAAACAGATATTGTATGG - Intergenic
942408476 2:175681523-175681545 GAATTAAATTAGATAATGTATGG - Intergenic
944976061 2:205052636-205052658 GGGTTAGATTAAATAATGTAGGG + Intronic
945234396 2:207621415-207621437 GGGTTAAATCAGATAGTGTATGG + Intronic
945539800 2:211071212-211071234 GGGTCAAATGAAATATTGTATGG - Intergenic
948125062 2:235558520-235558542 GGGTTAAAGCAGAAAGGGAAAGG - Intronic
1169713731 20:8592830-8592852 TGTTTAAATCAGATAATATATGG - Intronic
1170375097 20:15691613-15691635 GGATTAAATGAGATAATGCATGG + Intronic
1173542035 20:43861073-43861095 GGATTAAATGAGGTAATGTAAGG - Intergenic
1173948293 20:46968945-46968967 GGATTAAATCAACCAGTGTATGG + Intronic
1174550783 20:51360060-51360082 GGATTCAACCAGATAGTGCAGGG - Intergenic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1178125719 21:29513584-29513606 GGTTTAAATCAGACAGTGGCTGG - Intronic
1178235677 21:30838385-30838407 AGGTTGAAGCAGAAAGTGTAGGG - Intergenic
1181404135 22:22669980-22670002 GTGTTAACTAAGAAAGTGTACGG + Intergenic
1183378064 22:37476579-37476601 GGGTTAAATGAGAAAATGTCTGG - Intronic
950310574 3:11954310-11954332 GGATTAAATGAGATAGTGCATGG + Intergenic
950315546 3:11998812-11998834 GGATTAAATCAGATAGCACATGG + Intergenic
954910745 3:54105297-54105319 AGTTTAAATCACATAGAGTACGG - Intergenic
956280654 3:67552830-67552852 GGGCCAAATCAGATAATTTAAGG - Intronic
956302673 3:67789731-67789753 GGATTAAATGAGATAATGAATGG + Intergenic
956994580 3:74809813-74809835 AGGTTAAATCAGCTATTTTATGG + Intergenic
959576727 3:107942353-107942375 GGATCAAATGAGATAATGTAAGG - Intergenic
959714921 3:109422295-109422317 GTGTTAATTCACTTAGTGTAAGG + Intergenic
960597951 3:119423674-119423696 GGCATAAATAAGATAGTGCAGGG - Intergenic
961004819 3:123397870-123397892 GGGTGAAAACAGACAGTGAAGGG + Intronic
961144431 3:124582618-124582640 AGGATAAATGAGATAGTATATGG + Intronic
962345140 3:134613252-134613274 GGGGTAAATCAGAATGGGTATGG + Intronic
962424560 3:135258306-135258328 GGTTTAAATGAGATAGTGTATGG + Intronic
963328087 3:143884112-143884134 GGGCCAAATCTGATATTGTATGG + Intergenic
965065068 3:163838027-163838049 GGATTAAATGAGATAATATATGG + Intergenic
965887624 3:173467655-173467677 GAGATAAATGAGATAATGTATGG + Intronic
967292987 3:187939841-187939863 GGGTTTCATCAGAAAGTGTATGG + Intergenic
967509857 3:190298098-190298120 TGTTTATATCAGATAGTATATGG - Intergenic
981008006 4:139895493-139895515 AGGTTAAATGAAATAATGTAGGG + Intronic
984099756 4:175471417-175471439 ATGTGAAATCACATAGTGTAGGG + Intergenic
990286631 5:54306748-54306770 TGATTAAATGAGATAGTGGAGGG - Intronic
990616345 5:57512312-57512334 GGGCTAAATGAGATCATGTATGG - Intergenic
993658135 5:90597594-90597616 GGGTTAAATCTGATATTGAAGGG + Intronic
997369456 5:133348816-133348838 GGATTAAGTGAGATGGTGTACGG + Intronic
997756473 5:136404364-136404386 GAATTAAATGAGATAATGTATGG + Intergenic
997801499 5:136867231-136867253 GAGTTAGAGCAGAAAGTGTAAGG + Intergenic
998377998 5:141703724-141703746 GGATTAAATGAGAGAGTGCATGG + Intergenic
998977653 5:147665712-147665734 GGGTTAAACTAGATTGTGTACGG + Intronic
1001096300 5:168778204-168778226 GGGTTACATAAGATAGTGCCTGG - Intronic
1001541395 5:172542414-172542436 GGGTTAAGTGAGATAATGTATGG + Intergenic
1003588728 6:7418464-7418486 AGATGCAATCAGATAGTGTACGG + Intergenic
1004373490 6:15072742-15072764 GGGTTAACTGAGATAATGCATGG + Intergenic
1005561230 6:27043853-27043875 GGGTGAGGTCAGATAATGTAAGG - Intergenic
1006456332 6:34134025-34134047 GGCTTAAATGGGAGAGTGTATGG + Intronic
1006847839 6:37075246-37075268 GGATTAAATGAGATGATGTATGG - Intergenic
1007467801 6:42067018-42067040 GGATTTAATGAGATAATGTATGG - Intronic
1007769777 6:44183486-44183508 AGGTTAAACCAGTTAGTCTATGG + Intronic
1007827098 6:44608688-44608710 GGGCTAAATAAGAAAGTGAATGG + Intergenic
1007955854 6:45917269-45917291 GGGTTAACTCAGATAATGCAGGG + Intronic
1008137506 6:47794113-47794135 GGGTTAAATAAAATAATGTAAGG - Intronic
1010376715 6:75179068-75179090 TGGTTAAATGAGATAATCTATGG + Intronic
1011383121 6:86764427-86764449 GAGTTAAATGAGATAGCATATGG - Intergenic
1013898289 6:115120761-115120783 GGGATAAATCAGTTATTTTATGG - Intergenic
1014403718 6:121022890-121022912 TGGTTTAGTCAGATAGTGGATGG - Intergenic
1014870719 6:126593438-126593460 GAGTTAAATGAGATAGTGTATGG - Intergenic
1016961343 6:149675376-149675398 GTATTAAATCAGACAGTGTATGG + Intronic
1020590852 7:10134903-10134925 GGGTTTAATCATATAGTTTTGGG + Intergenic
1020817787 7:12927405-12927427 GGGTCAAATTAGATAATCTAAGG - Intergenic
1021915983 7:25432719-25432741 GGATTAAATGAGATAATATATGG + Intergenic
1021980240 7:26047065-26047087 GGATTAAATGAGATAATATATGG - Intergenic
1023098366 7:36686939-36686961 TGTTTAAATGAGATAGTGCAAGG + Intronic
1023360233 7:39407976-39407998 GGGTTAAAGCAGACATTGAAAGG - Intronic
1024772001 7:52734634-52734656 GTGTTAAATCATATACTTTATGG + Intergenic
1028617555 7:92786067-92786089 GGCTTAAGTCAGATAGAGTGTGG + Intronic
1031843782 7:126779965-126779987 GGATTAAATGAGACAATGTAAGG + Intronic
1032099697 7:128963834-128963856 GGGTAAAATCAGATATAGAAGGG - Intronic
1032537977 7:132680400-132680422 GGGTTAAATGAGGTGGTGTGTGG - Intronic
1033943699 7:146687383-146687405 GGTTTAAATGAGATAGTACATGG + Intronic
1034737830 7:153445506-153445528 AGATTAAATAAGATAATGTATGG - Intergenic
1035194888 7:157209582-157209604 GGGTTTAATCAAATATTGAAAGG - Intronic
1035838086 8:2778064-2778086 GGGTTAACTCACATTCTGTAAGG + Intergenic
1036828152 8:11995859-11995881 GGATTAAATCAGATCATGTATGG - Intronic
1036943492 8:13072897-13072919 GGGTTAAATAAGATAATGCCTGG + Intergenic
1038747004 8:30263314-30263336 GGGCCAAGTAAGATAGTGTAAGG - Intergenic
1039917917 8:41873417-41873439 GGATTAAATGAGATTGTGAATGG - Intronic
1041361403 8:57058173-57058195 GGACTAAATGAGATAGAGTAAGG + Intergenic
1045525837 8:102940658-102940680 GGGATAAATTAGATGATGTATGG + Intronic
1051431071 9:16981044-16981066 GGGTAGAGTCAGATGGTGTAGGG - Intergenic
1051815491 9:21100490-21100512 GGCTTATTTCAGTTAGTGTACGG + Intergenic
1053194754 9:36108419-36108441 GGATTTAATGAGATAATGTAAGG - Intronic
1053654872 9:40207235-40207257 GGATTAATTCAGATGGTGTTGGG + Intergenic
1053905258 9:42836444-42836466 GGATTAATTCAGATGGTGTTGGG + Intergenic
1054366987 9:64353451-64353473 GGATTAATTCAGATGGTGTTGGG + Intergenic
1054529728 9:66169080-66169102 GGATTAATTCAGATGGTGTTGGG - Intergenic
1054674615 9:67843192-67843214 GGATTAATTCAGATGGTGTTGGG + Intergenic
1056205984 9:84319876-84319898 GGGTTAAGTAATATCGTGTATGG - Intronic
1057284171 9:93735680-93735702 GGGTTCTATCAGAGAGTGGAGGG + Intergenic
1059672009 9:116500762-116500784 GAATTAATTTAGATAGTGTATGG + Intronic
1062175099 9:135157360-135157382 GGATTACATGAGATAGTGCATGG - Intergenic
1187239322 X:17498360-17498382 GGGATAAATCAGATAGAGGCAGG - Intronic
1188316859 X:28685607-28685629 GGGTTTAATCTGATAGTATAAGG + Intronic
1189171293 X:38912281-38912303 GGGTCAAATGAGATAGTTGAGGG + Intergenic
1193084081 X:77433057-77433079 GGGTTAACTAAGACAGTGAAAGG - Intergenic
1194444470 X:93971060-93971082 GGATTAAATCATATAATATATGG - Intergenic
1194778589 X:97995358-97995380 GGATTAAATGAGATAATATATGG - Intergenic
1194845676 X:98805217-98805239 AGGTTAAATAAAATATTGTATGG - Intergenic
1194940742 X:100007135-100007157 AGATTAAATCAGGTAGTGTTTGG - Intergenic
1195141772 X:101967790-101967812 AGATTAAATCAGATAATATATGG - Intergenic
1195616884 X:106919802-106919824 GGCTTAAATGACATAGTGCATGG + Intronic
1196002937 X:110806119-110806141 GGGTTAAAAAAGATGGTGTGTGG + Intergenic
1196236352 X:113285285-113285307 GGATTAAACGAGATAATGTATGG + Intergenic
1196762553 X:119212606-119212628 GGATTAAATGAGATATTGGAAGG - Intergenic
1197882114 X:131177911-131177933 GGATTAAATGAGATAATGCATGG + Intergenic
1198400849 X:136266755-136266777 GGATTAAATAAGATAGTGAATGG - Intergenic
1198787084 X:140300567-140300589 GGGTTAAGTCAGACACTCTATGG - Intergenic
1198977872 X:142357641-142357663 GGGTAAAATTAGATTGAGTAAGG + Intergenic