ID: 945236171

View in Genome Browser
Species Human (GRCh38)
Location 2:207633617-207633639
Sequence ACTGCTCAGCGCTACCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945236168_945236171 13 Left 945236168 2:207633581-207633603 CCGTAAGACCTGACTGCAGAGAG No data
Right 945236171 2:207633617-207633639 ACTGCTCAGCGCTACCTTGAGGG No data
945236169_945236171 5 Left 945236169 2:207633589-207633611 CCTGACTGCAGAGAGAAAAAACA No data
Right 945236171 2:207633617-207633639 ACTGCTCAGCGCTACCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945236171 Original CRISPR ACTGCTCAGCGCTACCTTGA GGG Intergenic
No off target data available for this crispr