ID: 945236488

View in Genome Browser
Species Human (GRCh38)
Location 2:207636391-207636413
Sequence CTGTTTCAGCCAAATGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945236479_945236488 8 Left 945236479 2:207636360-207636382 CCGAAAGGAACCTTTCCCCTCTC No data
Right 945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG No data
945236481_945236488 -7 Left 945236481 2:207636375-207636397 CCCCTCTCCTTGCCTGCTGTTTC No data
Right 945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG No data
945236483_945236488 -9 Left 945236483 2:207636377-207636399 CCTCTCCTTGCCTGCTGTTTCAG No data
Right 945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG No data
945236478_945236488 17 Left 945236478 2:207636351-207636373 CCACTGACTCCGAAAGGAACCTT No data
Right 945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG No data
945236482_945236488 -8 Left 945236482 2:207636376-207636398 CCCTCTCCTTGCCTGCTGTTTCA No data
Right 945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG No data
945236480_945236488 -2 Left 945236480 2:207636370-207636392 CCTTTCCCCTCTCCTTGCCTGCT No data
Right 945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG No data
945236476_945236488 29 Left 945236476 2:207636339-207636361 CCACAGGCAGCGCCACTGACTCC No data
Right 945236488 2:207636391-207636413 CTGTTTCAGCCAAATGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945236488 Original CRISPR CTGTTTCAGCCAAATGAATG GGG Intergenic
No off target data available for this crispr