ID: 945249604

View in Genome Browser
Species Human (GRCh38)
Location 2:207753131-207753153
Sequence AGGTGTGTGCTGGACTATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945249604_945249609 24 Left 945249604 2:207753131-207753153 CCAGTATAGTCCAGCACACACCT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 945249609 2:207753178-207753200 ATATAATAGCTAATAAGGATTGG 0: 1
1: 0
2: 1
3: 18
4: 217
945249604_945249610 25 Left 945249604 2:207753131-207753153 CCAGTATAGTCCAGCACACACCT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 945249610 2:207753179-207753201 TATAATAGCTAATAAGGATTGGG 0: 1
1: 1
2: 2
3: 19
4: 262
945249604_945249608 19 Left 945249604 2:207753131-207753153 CCAGTATAGTCCAGCACACACCT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 945249608 2:207753173-207753195 TGAGTATATAATAGCTAATAAGG 0: 1
1: 0
2: 0
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945249604 Original CRISPR AGGTGTGTGCTGGACTATAC TGG (reversed) Intronic
900239125 1:1606268-1606290 AGGTGTGGGCTGGGCTAGGCTGG + Intergenic
904424134 1:30412829-30412851 AGGTCTGTGCTGGACACTAGAGG - Intergenic
906570088 1:46830574-46830596 AGGTGTCTGTTGGCCTCTACTGG + Intergenic
915510149 1:156382528-156382550 AGGTGTCTGCTGGCCTACAAGGG + Intronic
916034797 1:160912292-160912314 AGGAGTGTCCTGGATTATCCAGG - Intergenic
919210293 1:194474245-194474267 AGGTGTGTGCGAGACTAGAAGGG - Intergenic
920660772 1:207912360-207912382 AGGTTTGAGATGGACTATAAAGG - Intergenic
921052348 1:211519917-211519939 AGGTGTGGGCTGGAATCTAAAGG + Intergenic
921425022 1:214991564-214991586 AGGTATGGGTTGGAATATACAGG - Intergenic
1063773205 10:9228186-9228208 AGGTTTGTGCTGTACTCTATTGG - Intergenic
1064094051 10:12409395-12409417 AGGTGTATGCTGTTCTAGACAGG + Intronic
1069150145 10:64950044-64950066 AGGTGTGTGCTGGATTTTGTGGG + Intergenic
1069259984 10:66382676-66382698 AGGTGTCTGTTGGCCTCTACTGG - Intronic
1069789819 10:71012355-71012377 AGGTGTGTGCAGGGCTATCAGGG + Intergenic
1069836889 10:71314872-71314894 TGGTGTGTGGTGGATTCTACGGG + Intergenic
1072480498 10:95806911-95806933 AGGTGTCTGCTGGCCCCTACTGG + Intronic
1075805308 10:125184383-125184405 AGGTGTCTGTTGGACCCTACTGG + Intergenic
1079015913 11:16868545-16868567 GGGGCTGTGCTGGACTCTACAGG - Intronic
1081323662 11:41719893-41719915 AAGCGTGTGCTGAACTAGACAGG - Intergenic
1081756330 11:45547414-45547436 AGCTCTGTGATGGACTAAACAGG - Intergenic
1082113123 11:48298938-48298960 AGGTGTGTGCAGGATTAGGCAGG + Intergenic
1083742897 11:64720518-64720540 AGGTGGGGGCTGGACTCCACTGG + Intronic
1091625761 12:2119582-2119604 TGGTGTGTGCTGGGCTCTAGTGG - Intronic
1101213670 12:102560079-102560101 AGGTGGGTGCTGGATCCTACAGG - Intergenic
1104000370 12:124856329-124856351 AGGTGTGTGCATGCCTACACAGG + Intronic
1104220276 12:126775933-126775955 ACGTGTGTGCTGTCCTATGCTGG + Intergenic
1106326267 13:28693483-28693505 AGGTGTCTGTTGGACCTTACTGG + Intergenic
1107366931 13:39689803-39689825 AGGTGTGTGCAGGCCTCTAAAGG + Exonic
1108217766 13:48201593-48201615 AGGTGTCTGTTGGACCCTACTGG - Intergenic
1113609189 13:111631301-111631323 AGGTGTGGGCTGGTCTAGCCTGG + Intronic
1113926508 13:113944556-113944578 AGGTGTGTGCTGGACCCTCCAGG + Intergenic
1115196724 14:30808538-30808560 AGCTGTGTCCTGGACTTTGCTGG - Intergenic
1116052792 14:39825434-39825456 AGGTGTCTGTTGGACCCTACTGG + Intergenic
1118251225 14:64163477-64163499 ATGTGGGTGCTGGACTCTGCGGG - Exonic
1121777199 14:96598520-96598542 AGGTGTCTGCTAGAGTCTACAGG + Intergenic
1123015821 14:105374714-105374736 AGGTGTGTGCTGGCTTATGAGGG + Intronic
1127253808 15:57270969-57270991 AGGTGTCTGTTGGCCTCTACTGG + Intronic
1129082604 15:73053143-73053165 AGGTGTGTAGTGGCCTCTACTGG - Intronic
1130439069 15:83933138-83933160 AGTTATGTGCTGGAGTAAACAGG + Intronic
1130627195 15:85527553-85527575 AGGTGTGGGCTGGAATATAGCGG + Intronic
1134239030 16:12490792-12490814 AGGTGTGCCCTGGAATACACAGG + Intronic
1135038670 16:19100257-19100279 CGGTGTGTGCTGAGCCATACTGG - Intergenic
1139298923 16:65927408-65927430 AGGTGTCTGCCGGCCTCTACTGG - Intergenic
1142431704 16:90032065-90032087 AGGTGTGTACGGGAATTTACAGG + Intronic
1146983754 17:37192069-37192091 AGGTGGGTGCTGTACTTTAATGG - Exonic
1148875095 17:50682511-50682533 AGGTGTGTTCTGGAGCACACTGG - Intronic
1151569474 17:74919038-74919060 CTGTGTGCGCTGGACTATATTGG - Intronic
1152488436 17:80611589-80611611 AGATGTGTGCAGGAGTATTCAGG - Intronic
1152681001 17:81667861-81667883 AGGTGTGTGCAGGCCCATACTGG + Exonic
1155605861 18:27605413-27605435 AAGTGTGTGCTGCCCTCTACTGG - Intergenic
1156447713 18:37249457-37249479 AGGTTTGTGCTGCAGTACACAGG - Intronic
1156575061 18:38305298-38305320 AGGTGTGGGCTGGAAGGTACAGG + Intergenic
1157066475 18:44356612-44356634 AGGTGTCTGTTGGACCCTACTGG + Intergenic
1159427517 18:68309324-68309346 AGATATTTTCTGGACTATACAGG + Intergenic
1163763829 19:19151441-19151463 AGGAGACTGCTGGACTATGCTGG + Intronic
1167724027 19:51199069-51199091 TGGAGTGTGCTGGTATATACGGG - Intergenic
927221271 2:20712121-20712143 AGGTGTCTGCTGGCCTCTACTGG - Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
937414062 2:121700225-121700247 AGGTGCGTGCTGGACTCCACTGG + Intergenic
944855542 2:203763777-203763799 AGGCTTGTGCTTGACTATTCTGG + Intergenic
945249604 2:207753131-207753153 AGGTGTGTGCTGGACTATACTGG - Intronic
1175822559 20:61918240-61918262 AGGAGTGTGCTGGGTTATTCTGG + Intronic
1179930172 21:44564774-44564796 AGGTGTCTGCTAGACTTTATTGG - Intronic
1182204562 22:28610304-28610326 AGGTGTCTGTTGGCCTCTACTGG - Intronic
1182288049 22:29259555-29259577 AGATGTGTGCTGGCCAATAAAGG + Exonic
1182858318 22:33537483-33537505 GGGAGTATCCTGGACTATACAGG - Intronic
1182990212 22:34760479-34760501 AGGTCTGGCCTGGAGTATACAGG + Intergenic
1184836656 22:47027879-47027901 AGGAGTGGGCTGGACAAGACAGG - Intronic
951532613 3:23711916-23711938 ACGTTTGAGCTGGACCATACAGG - Intergenic
951648526 3:24921654-24921676 AGGTCTGGGCTAGACTATGCGGG - Intergenic
953315936 3:41926065-41926087 AGGTGTCTGCTGGCCCCTACTGG - Intronic
961351673 3:126308231-126308253 AGGGTTGTGCTGGACTCAACCGG - Intergenic
967247513 3:187502886-187502908 TTGTGTGTGCTTGACTATATAGG - Intergenic
968057071 3:195699999-195700021 TGGTGTGTGCTGTGCTATCCAGG + Intergenic
970795138 4:19903360-19903382 ATTTGTGTGCTGTACTTTACTGG - Intergenic
970918811 4:21368847-21368869 ATGTATGTTCTGGATTATACAGG + Intronic
978928997 4:114287749-114287771 AGGTGTCTGTTGGACCCTACTGG - Intergenic
991936743 5:71809674-71809696 ATCTGTGTGCTGGAATATAATGG - Intergenic
993366673 5:87042437-87042459 AGGTGTCTGTTGGCCCATACTGG + Intergenic
998728392 5:145044966-145044988 AGGTGTAGGCTGGTCTATATTGG + Intergenic
1001708068 5:173756478-173756500 ACATGTGTCCTGGTCTATACAGG + Intergenic
1001826898 5:174752284-174752306 AGGTGTGTAGTAGGCTATACCGG - Intergenic
1002673049 5:180885810-180885832 AGGTGTCTGTTGGCCTCTACTGG + Intergenic
1005955302 6:30659487-30659509 TGGTGTGGGCTGGAAGATACGGG + Exonic
1006818644 6:36872564-36872586 AGGTATGTGCTGGAGTAGAGGGG - Intronic
1010822604 6:80433086-80433108 AGGTGTCTGTTGGCCCATACTGG + Intergenic
1012585205 6:100913524-100913546 AGGTGTGTGTTGGCCGCTACTGG + Intergenic
1015916615 6:138224028-138224050 ACCTGTGTGCTGGATTATTCAGG - Intronic
1016345022 6:143104103-143104125 AGGTGAGGGTTGGTCTATACTGG + Intronic
1019172524 6:170141542-170141564 AGGTGTATGTTGGGCTACACCGG + Intergenic
1019384306 7:746183-746205 GGGTGTGTGCTTGGCAATACAGG - Intronic
1022459669 7:30593838-30593860 AGGAGTGTGCAGGAGTAGACGGG - Intergenic
1029173451 7:98646847-98646869 ATGTGTGTGCTGGACACTATTGG + Intergenic
1031439441 7:121775205-121775227 AGGTATGTGCAGGACTACACAGG + Intergenic
1032433403 7:131881123-131881145 AGGCATGTGCTGGAGTATATGGG - Intergenic
1034517383 7:151591396-151591418 CGGTGTGGGCTGGACTAGACAGG + Intronic
1035037951 7:155907611-155907633 GTGTGTGTGCTGGACTCTGCTGG + Intergenic
1038392192 8:27212450-27212472 AGGGGTGTGCGGAAGTATACAGG - Intergenic
1038479410 8:27891604-27891626 AGGTGTTGGCTGGAACATACAGG - Intronic
1039192626 8:34994326-34994348 AGGTTTGTGTTGGACAAGACTGG - Intergenic
1040979774 8:53234423-53234445 AGGTGTGTCCTGGACTTGCCAGG + Intronic
1043089142 8:75875805-75875827 AGGTGTCAGTTGGCCTATACTGG + Intergenic
1046121136 8:109848611-109848633 AGGTGTGTGCTGGTACATAGTGG + Intergenic
1047296699 8:123576560-123576582 GGGTGTGGGCTGCACTATACGGG + Intergenic
1050603246 9:7273759-7273781 CGGTGTGTGCTGGCCTCTAGTGG - Intergenic
1054890048 9:70241020-70241042 AGGTGTCTGTTGGACCCTACTGG - Intergenic
1057645410 9:96869812-96869834 AGGTATGTGCTGGACTGCATTGG - Intronic
1061592874 9:131609408-131609430 AGGTGTATCCTGGACGAGACAGG + Intronic
1187248307 X:17574084-17574106 AGGTGTCTGTTGGCCTCTACTGG + Intronic
1192637107 X:72830552-72830574 AGGTGTCTGTTGGACCCTACTGG + Intronic
1192644607 X:72890262-72890284 AGGTGTCTGTTGGACCCTACTGG - Intronic
1192886523 X:75341058-75341080 ATGTGTGTGCTGGTGTATGCTGG - Intergenic
1193654785 X:84186808-84186830 AGGTGTATGGTGGCCTCTACTGG + Intronic
1197489832 X:127102952-127102974 AGGTGTCTGTTGGTCCATACTGG - Intergenic
1198395045 X:136212064-136212086 AGGTGTCTGCTGCACTCTCCTGG + Intergenic
1198441394 X:136666826-136666848 AGCTGTGTGCTGGATTATTCAGG - Exonic
1199265981 X:145826075-145826097 AGGTGTGTGGCGGCCTCTACTGG - Intergenic