ID: 945250341

View in Genome Browser
Species Human (GRCh38)
Location 2:207760559-207760581
Sequence AGGCACTTTCAGCTGATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945250341_945250345 23 Left 945250341 2:207760559-207760581 CCTCTCATCAGCTGAAAGTGCCT 0: 1
1: 0
2: 0
3: 19
4: 138
Right 945250345 2:207760605-207760627 GGCAGTGTGGTGTCCTGCACTGG 0: 1
1: 0
2: 1
3: 22
4: 231
945250341_945250346 30 Left 945250341 2:207760559-207760581 CCTCTCATCAGCTGAAAGTGCCT 0: 1
1: 0
2: 0
3: 19
4: 138
Right 945250346 2:207760612-207760634 TGGTGTCCTGCACTGGATCCTGG 0: 1
1: 0
2: 22
3: 88
4: 515
945250341_945250343 2 Left 945250341 2:207760559-207760581 CCTCTCATCAGCTGAAAGTGCCT 0: 1
1: 0
2: 0
3: 19
4: 138
Right 945250343 2:207760584-207760606 GAAAAACAAAGCTTCTCTAAAGG 0: 1
1: 0
2: 1
3: 29
4: 375
945250341_945250344 10 Left 945250341 2:207760559-207760581 CCTCTCATCAGCTGAAAGTGCCT 0: 1
1: 0
2: 0
3: 19
4: 138
Right 945250344 2:207760592-207760614 AAGCTTCTCTAAAGGCAGTGTGG 0: 1
1: 0
2: 1
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945250341 Original CRISPR AGGCACTTTCAGCTGATGAG AGG (reversed) Intronic
901977960 1:13010390-13010412 AGTAACTTTCTGCTGATGAGAGG - Intronic
902004126 1:13218547-13218569 AGTAACTTTCTGCTGATGAGAGG + Intergenic
902023350 1:13364288-13364310 AGTAACTTTCTGCTGATGAGAGG + Intergenic
903662030 1:24984202-24984224 GGGCAATTTCAGGTGGTGAGTGG + Intergenic
904779795 1:32937191-32937213 AGCCACTATCAGCTGGTGAGTGG - Exonic
905245813 1:36612523-36612545 AGGCACTCTAAGCTCAGGAGTGG + Intergenic
917924501 1:179778024-179778046 ATGCATTTTCAACTGATGACAGG - Intronic
918059523 1:181049231-181049253 AGGTACACTCAGCTGCTGAGGGG + Exonic
923247168 1:232143677-232143699 AGGCACTTTAAGGAGATTAGGGG + Intergenic
1065764193 10:29011369-29011391 AAGCACTTTCAGGTGATCAAAGG - Intergenic
1066710033 10:38223473-38223495 AAGCTCTTTCAGCTGCTAAGAGG - Intergenic
1066979978 10:42403981-42404003 AAGCTCTTTCAGCTGCTAAGAGG + Intergenic
1068751064 10:60592857-60592879 AGGCTCTTTGAGCTGTTGACTGG + Intronic
1073112270 10:101069877-101069899 AGTCACTTGCAGATAATGAGGGG + Intergenic
1073433399 10:103501313-103501335 AGGCATCTTGAGCTGCTGAGAGG + Intronic
1073763581 10:106657206-106657228 AGTGCCTATCAGCTGATGAGTGG + Intronic
1075531933 10:123237027-123237049 AGGAAATTAAAGCTGATGAGAGG - Intergenic
1076499862 10:130929022-130929044 GGGCACTCACAGCTGGTGAGGGG - Intergenic
1077203176 11:1324010-1324032 AGGCACCTGCAGGAGATGAGCGG - Intergenic
1078087677 11:8243902-8243924 ATGCACTGTGAGCTGATGATAGG - Intronic
1078402183 11:11038146-11038168 AGGCACTATCAGCTTGTCAGAGG + Intergenic
1084422621 11:69067911-69067933 AGCCACTTTCAGCTTCTCAGAGG - Intronic
1089238570 11:117054056-117054078 AGGCAATATAAGCTGGTGAGAGG - Intronic
1089973714 11:122714730-122714752 AAGCAATGTCAGCTGATGATGGG + Intronic
1092231402 12:6777656-6777678 AGGGTCATTCAGCTGATCAGTGG - Intronic
1094844004 12:34353555-34353577 AGGCACTTTCACCTGTGGAAGGG + Intergenic
1094845091 12:34357998-34358020 AGGCACTTTCGCCCGTTGAGGGG + Intergenic
1094845834 12:34360997-34361019 AGGCACTTTCTCCTGTGGAGGGG + Intergenic
1094846118 12:34362123-34362145 AGGCACTTTCACCCGTGGAGTGG + Intergenic
1094852700 12:34389373-34389395 AGGCACTTTCACCCGTTGGGGGG - Intergenic
1094853268 12:34391815-34391837 AGGCACTTTCACCCGTCGAGGGG - Intergenic
1094872490 12:34606098-34606120 AGGCACTTTCACCTGTTGTGGGG - Intergenic
1095974063 12:47927345-47927367 AGGCACTTTCAGGGGATCTGAGG - Intronic
1100384299 12:94091541-94091563 AGGCACTCTCAGCTGAGTGGAGG + Intergenic
1101820329 12:108179245-108179267 AGGAACTTTCAGCGGGGGAGGGG + Intronic
1104672451 12:130690049-130690071 AGGCACTGCCAGTTGCTGAGAGG - Intronic
1106616231 13:31331101-31331123 AGGGATGATCAGCTGATGAGAGG + Exonic
1108748787 13:53424702-53424724 GGACACTTACATCTGATGAGTGG + Intergenic
1116632157 14:47349912-47349934 AGGCACTGGCAGGAGATGAGAGG + Intronic
1118372432 14:65149002-65149024 AGGATCTTTCAGCAGAGGAGAGG - Intergenic
1118714002 14:68546411-68546433 AGGAACCTTCAGGTGAAGAGGGG + Intronic
1122184657 14:99981995-99982017 AAGCACTTCCAGCTGATGTCGGG + Intronic
1127385960 15:58467364-58467386 AGGCACTGTGAGCTCAAGAGCGG - Intronic
1127410104 15:58697284-58697306 ATAAACATTCAGCTGATGAGTGG - Intronic
1128662922 15:69515527-69515549 AGGATCCATCAGCTGATGAGTGG - Intergenic
1129905825 15:79186538-79186560 GGGCAATTTTAGCTGATGGGGGG - Intergenic
1130228894 15:82081533-82081555 TGGCACTTTCTGCTCATGAGTGG - Intergenic
1132768320 16:1546407-1546429 AGGCACTCACAGCTGACCAGGGG - Intronic
1135107052 16:19658965-19658987 AGGAACATCCAGCTAATGAGTGG + Intronic
1135889081 16:26341258-26341280 GGGAAAGTTCAGCTGATGAGTGG + Intergenic
1138737072 16:59262911-59262933 AGCCACTTTCTGCTCATGATTGG + Intergenic
1139583057 16:67884625-67884647 AGGCAGTTGGAGCAGATGAGTGG - Intergenic
1140882385 16:79210572-79210594 ACTAATTTTCAGCTGATGAGAGG - Intronic
1141503449 16:84460278-84460300 GGTCTCTCTCAGCTGATGAGGGG + Intronic
1142997343 17:3768746-3768768 AGGCACTATCAGATGATGGCAGG - Intronic
1143553847 17:7648765-7648787 AAGAACTTTCAGCTGAGGAGTGG - Intronic
1144054817 17:11530946-11530968 AGGCAGTATCAGCTGATGTTTGG + Intronic
1145061647 17:19737861-19737883 AGGCCCCACCAGCTGATGAGAGG + Intergenic
1146299453 17:31676830-31676852 AGGCACACACAGCTGGTGAGTGG - Intergenic
1147670523 17:42174398-42174420 AGGCACCATCAGCTGGGGAGTGG - Intronic
1148325195 17:46779340-46779362 TGGCACTGACAGCTGGTGAGGGG + Intronic
1148467434 17:47873325-47873347 GGGCTCTTTCATCTGAAGAGGGG - Intergenic
1150445457 17:65224555-65224577 AAACACTTTTAGCTGATAAGTGG - Intronic
1152020946 17:77779936-77779958 GTGCATCTTCAGCTGATGAGAGG + Intergenic
1152871333 17:82754808-82754830 AAGCAGTTTCAGCTGCTGAGAGG + Intronic
1153027800 18:687196-687218 AAGTACTTGCAGCGGATGAGGGG + Intronic
1157696907 18:49730399-49730421 AGACATTTTCAGCTTATGATGGG + Intergenic
1159353333 18:67302054-67302076 AGATACTTTCATCTGATGAAAGG + Intergenic
1161026266 19:2038751-2038773 AGGCACTGTCAGCCAATGTGGGG - Exonic
1166067155 19:40366599-40366621 AGGCACCTTCAGCTGGGGATGGG - Exonic
1166514971 19:43439577-43439599 AAGAACTTTGAGCTGATGAGAGG + Intergenic
1168348194 19:55660937-55660959 AGGAGCTTTCTGCTGAGGAGGGG + Intronic
926780424 2:16466153-16466175 AGGCACATTCTGCTGAGGAAGGG - Intergenic
927919627 2:26961898-26961920 TGGCGCTTTCAGCTCATCAGTGG + Intergenic
928199371 2:29237546-29237568 AGGAACTTACATCTGAGGAGAGG - Intronic
929362217 2:41105705-41105727 AGGCTCTTCCAGCTCATGATTGG + Intergenic
929908996 2:46072963-46072985 AGGTACTTCCTACTGATGAGTGG - Intronic
931374226 2:61693802-61693824 AAGCACTTGCAGCAGGTGAGTGG + Intergenic
931486424 2:62697534-62697556 AGAAAATTTCAGTTGATGAGAGG - Intronic
934564561 2:95331096-95331118 AGGCCCCTCCTGCTGATGAGGGG + Intronic
936077273 2:109409593-109409615 CAGCACTCTCAGCTGGTGAGGGG - Intronic
938272463 2:129985972-129985994 ATGCACTGGCAGCTGATTAGAGG - Intergenic
944799280 2:203221605-203221627 AAACAGTTTCAGCTGATGAGAGG - Intronic
945250341 2:207760559-207760581 AGGCACTTTCAGCTGATGAGAGG - Intronic
945480082 2:210335291-210335313 AGGGTCTTTCAGCGGATCAGGGG + Intergenic
1170284333 20:14689708-14689730 AGGCATTTTTAGCTGAGGTGAGG - Intronic
1170663804 20:18367477-18367499 AGGAAGTTTCTGCTGAGGAGAGG + Intergenic
1170796281 20:19549838-19549860 ATCCACTTCCAACTGATGAGGGG + Intronic
1175326074 20:58129344-58129366 AGCCACATTCAGCTGAGGATTGG + Intergenic
1177766446 21:25462855-25462877 AGGCACGTGCACCTGAAGAGAGG + Intergenic
1182879768 22:33723462-33723484 AGGTACTGTAAGGTGATGAGTGG + Intronic
1184210199 22:43030813-43030835 AGGGACTGTTAGGTGATGAGGGG - Intergenic
950641193 3:14349568-14349590 AGGCATTTTCACCTGGTGTGGGG + Intergenic
950925924 3:16742005-16742027 AGCTGCATTCAGCTGATGAGTGG + Intergenic
951927709 3:27926587-27926609 AAGCTCATACAGCTGATGAGTGG + Intergenic
952189609 3:31008860-31008882 ATGCACTTACAGCTGAGTAGGGG - Intergenic
953268545 3:41416937-41416959 GTGCACTTTCAGCTGAGCAGAGG - Intronic
954702436 3:52457287-52457309 AGGCACAAGCAGCTGATGTGGGG - Intronic
955774963 3:62423131-62423153 AGTCTCTTTCAGCTGAGGATGGG + Intronic
956037971 3:65116457-65116479 AGGCACTTTGAGATGCTGAGGGG + Intergenic
959517273 3:107282973-107282995 AGGCAATTTAAACTGATGTGAGG + Intergenic
959606885 3:108250719-108250741 AGCCACTTCCTGCTGATTAGCGG - Intergenic
959905027 3:111701893-111701915 AGGCACTTTGTGGGGATGAGAGG + Intronic
962597326 3:136959868-136959890 AGCCACTTTGAGGTTATGAGGGG + Intronic
963079264 3:141376093-141376115 AGACACTGTCAGGTGATCAGTGG - Intronic
964223613 3:154372062-154372084 GGCTACTTTCTGCTGATGAGGGG - Intronic
970442212 4:16091215-16091237 ACGTACTTTCAGATGATGATGGG - Intergenic
971373185 4:26034671-26034693 AGGCACTGGCAGGAGATGAGGGG - Intergenic
972644351 4:40953771-40953793 AGGCACTGTCACCTGCTGACAGG + Intronic
974102717 4:57435733-57435755 AGGCACTGTCGGCTGGGGAGGGG + Intergenic
978822445 4:112980967-112980989 AAGAACTTACAGCTGATAAGAGG + Intronic
978892694 4:113848906-113848928 AGGCACTGTCATTTGATCAGGGG - Intergenic
986026781 5:3858554-3858576 AGGCACATTCAGCAGGAGAGAGG - Intergenic
990381689 5:55226451-55226473 AGGCACACTCAGCTGGTGAGGGG - Intronic
990513595 5:56511748-56511770 AAGAAGTTTCAGATGATGAGTGG + Intronic
990651945 5:57910401-57910423 AAGCACTTTCAGAGGCTGAGGGG + Intergenic
992717873 5:79529504-79529526 AGGCACTTTCAGCCGCTTATAGG - Intergenic
992743009 5:79792742-79792764 AAGCACTTTCAACTGCTGATGGG - Intronic
993228112 5:85195559-85195581 AGACACTTTCAAATGAAGAGTGG - Intergenic
998265816 5:140666985-140667007 AGGCCATTACAGCTAATGAGGGG - Intronic
998804687 5:145906947-145906969 AGGGACTTGCAGTTGGTGAGGGG + Intergenic
999126006 5:149246317-149246339 GACCACTTTCAGCTGATGTGGGG + Intronic
999837945 5:155394656-155394678 AGGCTCCCTCAGCTGATAAGTGG - Intergenic
1000153214 5:158523982-158524004 AGGCACTTTCACCAGAACAGTGG - Intergenic
1005209925 6:23448828-23448850 ATGTGCTCTCAGCTGATGAGAGG + Intergenic
1007146896 6:39644415-39644437 AGTGACCGTCAGCTGATGAGTGG + Intronic
1007248447 6:40479336-40479358 AGCCACTGTCAGCTCAGGAGTGG - Intronic
1010932445 6:81819074-81819096 AGGCAATTTGAGCTGAACAGAGG - Intergenic
1012411329 6:98961293-98961315 AGGTATTTTAAGCTGATGAGAGG - Intergenic
1013580853 6:111533207-111533229 AGGATCTTTCAGTTGCTGAGTGG - Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1022579823 7:31540116-31540138 AGCTACTTCCTGCTGATGAGGGG + Intronic
1026659998 7:72292420-72292442 AGGCCCTATCTGCTAATGAGTGG - Intronic
1033872056 7:145766047-145766069 AAATACTTTCAGCTGATGAATGG + Intergenic
1034553064 7:151833393-151833415 AGGCTGTTCCAGCTGCTGAGCGG + Intronic
1035623160 8:1050515-1050537 CGGCATTTTCAGCTCATGATGGG + Intergenic
1035766063 8:2106350-2106372 AGGAGATTTCAGATGATGAGAGG + Exonic
1038688577 8:29741042-29741064 AGGCAGTTTCAGCAGAAGAAGGG - Intergenic
1041757968 8:61334691-61334713 AGGCACTTTCCACTGAGGGGAGG + Intronic
1042397117 8:68305772-68305794 AGGAACACTCAGCTGATAAGGGG + Intronic
1043046807 8:75335454-75335476 ATGCACTTTCTGCTGTTGACTGG + Intergenic
1046611272 8:116428206-116428228 AGGTAATTTCATCTGCTGAGAGG + Intergenic
1046896708 8:119480838-119480860 AAGCACGTTCAGCTGATGCATGG - Intergenic
1047218284 8:122897149-122897171 AGTCACTTCCAGATCATGAGAGG + Intronic
1048831956 8:138486288-138486310 AGGCATTTTCAGAGGATCAGAGG + Intronic
1049522690 8:143102385-143102407 AGACACTTTCTGCTGACGAGTGG - Intergenic
1049732132 8:144184003-144184025 AGTCACTTTTTGCTGAGGAGGGG - Intronic
1052417635 9:28198600-28198622 AGGAACTTCCAGCTGCTGAGAGG + Intronic
1057089335 9:92242647-92242669 AGGCTGTTCCAGCAGATGAGTGG - Intronic
1057571732 9:96209226-96209248 AGGGACTTCCAGCTAATGAGTGG + Intergenic
1186400276 X:9252039-9252061 AGGCATTTTCAACTAATTAGAGG - Intergenic
1189535398 X:41929799-41929821 AGACACTTTCAGCAGAAGAAGGG + Intergenic
1192382008 X:70626694-70626716 GGCCACATTCAGCTGATGAGTGG - Intronic
1192759879 X:74085981-74086003 AGGCACTTTCACATGATGCAAGG + Intergenic
1194659073 X:96608684-96608706 AGGCACTTTCAGCCTATCAAAGG - Intergenic
1196643041 X:118085859-118085881 AGTGACCATCAGCTGATGAGTGG - Intronic
1198390772 X:136171533-136171555 TGGCATTTCCAGCTGATGAGAGG - Intronic
1199526973 X:148803720-148803742 AGGTACTCTCAGCTGATGATGGG + Intronic