ID: 945251044

View in Genome Browser
Species Human (GRCh38)
Location 2:207767069-207767091
Sequence GGGGTAGTCCCCTGCGGCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945251036_945251044 9 Left 945251036 2:207767037-207767059 CCGGTCCTGCCTGTGAGCGCGGC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 945251044 2:207767069-207767091 GGGGTAGTCCCCTGCGGCCATGG 0: 1
1: 0
2: 1
3: 5
4: 88
945251032_945251044 18 Left 945251032 2:207767028-207767050 CCCGGCGGCCCGGTCCTGCCTGT 0: 1
1: 0
2: 1
3: 17
4: 208
Right 945251044 2:207767069-207767091 GGGGTAGTCCCCTGCGGCCATGG 0: 1
1: 0
2: 1
3: 5
4: 88
945251033_945251044 17 Left 945251033 2:207767029-207767051 CCGGCGGCCCGGTCCTGCCTGTG 0: 1
1: 0
2: 2
3: 21
4: 204
Right 945251044 2:207767069-207767091 GGGGTAGTCCCCTGCGGCCATGG 0: 1
1: 0
2: 1
3: 5
4: 88
945251038_945251044 0 Left 945251038 2:207767046-207767068 CCTGTGAGCGCGGCGCTCGCCTC 0: 1
1: 0
2: 0
3: 8
4: 66
Right 945251044 2:207767069-207767091 GGGGTAGTCCCCTGCGGCCATGG 0: 1
1: 0
2: 1
3: 5
4: 88
945251034_945251044 10 Left 945251034 2:207767036-207767058 CCCGGTCCTGCCTGTGAGCGCGG 0: 1
1: 0
2: 0
3: 15
4: 139
Right 945251044 2:207767069-207767091 GGGGTAGTCCCCTGCGGCCATGG 0: 1
1: 0
2: 1
3: 5
4: 88
945251037_945251044 4 Left 945251037 2:207767042-207767064 CCTGCCTGTGAGCGCGGCGCTCG 0: 1
1: 0
2: 3
3: 4
4: 67
Right 945251044 2:207767069-207767091 GGGGTAGTCCCCTGCGGCCATGG 0: 1
1: 0
2: 1
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945251044 Original CRISPR GGGGTAGTCCCCTGCGGCCA TGG Exonic