ID: 945251243

View in Genome Browser
Species Human (GRCh38)
Location 2:207768136-207768158
Sequence GCCCTTCGTGCCCATTCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945251243_945251246 11 Left 945251243 2:207768136-207768158 CCTTCAGAATGGGCACGAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 75
Right 945251246 2:207768170-207768192 GCACACGAACGGGCCCCCAGCGG 0: 1
1: 0
2: 0
3: 3
4: 56
945251243_945251247 12 Left 945251243 2:207768136-207768158 CCTTCAGAATGGGCACGAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 75
Right 945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG 0: 1
1: 0
2: 0
3: 4
4: 51
945251243_945251244 0 Left 945251243 2:207768136-207768158 CCTTCAGAATGGGCACGAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 75
Right 945251244 2:207768159-207768181 TCGCGACACTTGCACACGAACGG 0: 1
1: 0
2: 0
3: 0
4: 10
945251243_945251248 13 Left 945251243 2:207768136-207768158 CCTTCAGAATGGGCACGAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 75
Right 945251248 2:207768172-207768194 ACACGAACGGGCCCCCAGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 35
945251243_945251245 1 Left 945251243 2:207768136-207768158 CCTTCAGAATGGGCACGAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 75
Right 945251245 2:207768160-207768182 CGCGACACTTGCACACGAACGGG 0: 1
1: 0
2: 0
3: 0
4: 11
945251243_945251253 29 Left 945251243 2:207768136-207768158 CCTTCAGAATGGGCACGAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 75
Right 945251253 2:207768188-207768210 AGCGGGGCATTCGCCCCCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945251243 Original CRISPR GCCCTTCGTGCCCATTCTGA AGG (reversed) Exonic
900566409 1:3334339-3334361 GGCCTTTGTGCCCTTCCTGATGG - Intronic
900696114 1:4011403-4011425 GCCCCTCGTGCACCTTCTGCAGG + Intergenic
902247810 1:15133108-15133130 GCACCTCGTGACCATTCTGCAGG - Intergenic
903447399 1:23431171-23431193 GCCCTTTCTCCCCACTCTGAGGG - Intronic
906179372 1:43805182-43805204 GCCCTTCATGTTCTTTCTGAGGG - Intronic
907608815 1:55847098-55847120 AACCTTCATGACCATTCTGAAGG + Intergenic
915465385 1:156094673-156094695 GGCCTTCCTGACCATGCTGATGG + Intronic
918004585 1:180529876-180529898 GCCCTTTGTCCCCATACAGAAGG - Intergenic
1064839823 10:19578782-19578804 GCCCTTCCTTCCTCTTCTGATGG + Intronic
1065741990 10:28805313-28805335 GGCCTTCATGCCAAGTCTGATGG + Intergenic
1081870072 11:46379379-46379401 GAACTTCCTGCCCTTTCTGATGG + Intronic
1084416720 11:69036747-69036769 TCCCTTCATGCCCATTCTCTGGG - Intergenic
1089621968 11:119727645-119727667 GCCCTGGTGGCCCATTCTGACGG - Intronic
1093147341 12:15582224-15582246 GGCCTTGATGCCCATGCTGAAGG - Intronic
1098515916 12:71376734-71376756 GGCCTTGGCGCCCATTCTGGCGG + Intronic
1100464928 12:94836111-94836133 CCCCTTTGAGCCCAATCTGAGGG + Intergenic
1103903166 12:124314110-124314132 CCCTTTCGTGTCCATGCTGAGGG + Intronic
1105928565 13:25031480-25031502 TCCCTTGGTGCCTTTTCTGAAGG + Intergenic
1106053035 13:26209271-26209293 TCCCTTGGTGCCTTTTCTGAAGG + Intronic
1106396457 13:29385497-29385519 CCCATTTGTGCCCTTTCTGAAGG - Intronic
1108620248 13:52175694-52175716 GCTCTTCAAACCCATTCTGAAGG + Intergenic
1110236603 13:73223432-73223454 GCCCTCCCTGCCCCTTCTGAAGG - Intergenic
1117958669 14:61142246-61142268 ACCCTTCCTGCCCATTTTGATGG - Intergenic
1123954591 15:25322155-25322177 GCCCTGTGTGTCCTTTCTGAGGG - Intergenic
1132505853 16:308353-308375 GTCCTTCCTGACCCTTCTGAGGG + Intronic
1136066930 16:27765594-27765616 GCCCTTCCTTCCCATGCTGGGGG - Intronic
1136515243 16:30764390-30764412 GTTCTTTGTGCCCATACTGAAGG + Intronic
1138500969 16:57444051-57444073 GCCCTTCGTTTCCTTTATGAGGG - Intronic
1139700781 16:68706906-68706928 GCCCTTGCTGCCCAGTCTAAGGG + Intronic
1142018577 16:87765876-87765898 GCCCTTCTTGCCCATCTTGCCGG + Exonic
1146838109 17:36128515-36128537 GCCCTTCCTGGCAATTTTGATGG + Intergenic
1147930062 17:43973865-43973887 GCCCTTCGTGACCAGGCTCAAGG - Intronic
1153103096 18:1496996-1497018 GCCCTAAGTGCCCATTTTGGTGG - Intergenic
1161058949 19:2204847-2204869 GCCCTTCCTGCTCCTCCTGAGGG + Intronic
1162220929 19:9175683-9175705 ACCCTTCCTGCCCATTCTGCAGG + Intergenic
1162444187 19:10712436-10712458 TCCCTTGGGGGCCATTCTGAGGG + Intronic
1163263152 19:16203509-16203531 GCACTTCATGCCCATCCTGATGG + Exonic
1163464729 19:17460704-17460726 GGCCTTCGTGCCCATCCTCAAGG - Exonic
1164623089 19:29708981-29709003 GCACTTCCTGCCCATCCTGCTGG - Intronic
926969096 2:18448901-18448923 GCTCTTCTTGCCCATGCTGCAGG + Intergenic
929070730 2:38028606-38028628 GCCCTTCGAGCCCATTAAGCTGG + Intronic
932218084 2:69979567-69979589 GGCCTTTGTGCCCAGTTTGAGGG - Intergenic
932400257 2:71475598-71475620 CCCCTCTGTGCCCACTCTGATGG - Intronic
933720663 2:85395457-85395479 GCCCTTCCTGGCCAATTTGAGGG + Intronic
936749283 2:115621710-115621732 GCTCTTCGTGCCCAGGCTGGAGG + Intronic
937090594 2:119203799-119203821 GCCCTTGGGACCCATTCTTATGG - Intergenic
945251243 2:207768136-207768158 GCCCTTCGTGCCCATTCTGAAGG - Exonic
1176085210 20:63292756-63292778 GCCCTCCCAGCCCATCCTGAAGG - Intergenic
963168019 3:142225083-142225105 GCCCTTCCTGTCCAGGCTGAGGG - Intronic
966506107 3:180703597-180703619 GCCCATGATGCCCATACTGAAGG + Intronic
969123368 4:4926331-4926353 GGCCATCATGCCCATGCTGAAGG + Intergenic
979669404 4:123346467-123346489 TCTCTTCTTGCCCATTCTGCAGG + Intergenic
981523633 4:145690799-145690821 GCCCTTTGTGCACTTTTTGATGG - Intronic
982219907 4:153115451-153115473 GCCCATGGTGCTCATCCTGAGGG + Intergenic
985107642 4:186514657-186514679 ACACTTTGTGCCCACTCTGAGGG - Intronic
987103354 5:14612831-14612853 GCCTTACGTGTCCATACTGAGGG + Intronic
992958117 5:81931376-81931398 GCCATTTGTGCCCAGCCTGAAGG + Intergenic
998452381 5:142244939-142244961 GAGCTTCCTGCCCATTCTCAGGG - Intergenic
999217316 5:149946075-149946097 GCCCTTCCTGCCCACTAGGAAGG + Intergenic
1003925257 6:10871556-10871578 GCCCTTCCTCCCCATCCTGCCGG + Intronic
1007075838 6:39065621-39065643 CCCCTTCCTCCCCATTCTGAGGG - Intronic
1009430561 6:63560899-63560921 GCCCTTCCTTTTCATTCTGATGG - Intronic
1016918119 6:149264102-149264124 GCGCTACCTGCCCATTCTGCTGG - Intronic
1019068364 6:169321650-169321672 GCCGTGCGTGCCCATGCTGAGGG - Intergenic
1021285175 7:18771916-18771938 GCCCTTCATGCCTTATCTGATGG - Intronic
1031661411 7:124429628-124429650 GACCTTCTTTCCCATTCAGAAGG - Intergenic
1032794798 7:135268951-135268973 ACCCTTCCCGCCCATTCTGATGG + Intergenic
1034054429 7:148019740-148019762 AGCCATCGTGCCCATTCTCAGGG + Intronic
1035071636 7:156149080-156149102 GCCCTTGGTGTCCGTCCTGATGG - Intergenic
1035238207 7:157513944-157513966 TCCCTTCGTGCTGTTTCTGAGGG + Intergenic
1038407785 8:27334827-27334849 GCCCTTCTTGCCTGTCCTGAAGG + Intronic
1038863800 8:31416363-31416385 TCCCTTTGGGCCCATTCTGAGGG + Intergenic
1041680406 8:60583131-60583153 GCCGTCCATGCGCATTCTGAGGG + Intronic
1041780091 8:61568448-61568470 GCCCTTTCTTCCCATTCTCAAGG - Intronic
1043969475 8:86514278-86514300 GCGCTTCGAGGCCATTCTGGAGG - Intronic
1047468378 8:125142635-125142657 GCCCTTGTTGCCCATGCTGGAGG + Intronic
1049169670 8:141151735-141151757 CCCCTTCGTGCCCATCCTGTCGG + Exonic
1049369679 8:142257824-142257846 GCCCTTTCTGCCCACTCTGCTGG + Intronic
1055423841 9:76172514-76172536 TCCCTTTGTGCCATTTCTGAAGG - Intronic
1056506249 9:87260914-87260936 GCCCTTCATCCCCACTCTAAAGG - Intergenic
1059348418 9:113647908-113647930 GCCCTCCCTGACCATTCTGAGGG + Intergenic
1060508247 9:124214467-124214489 GCCCATGGTGCCCACTCTGCCGG - Intergenic
1060662124 9:125410763-125410785 GCCCCTCCTGCCCCTTCTGCCGG - Intergenic
1061359528 9:130132196-130132218 GCCCTTCCTGTCCATTCTCCCGG + Intronic
1062043457 9:134414724-134414746 GCCCTTGCTGCCCATCCTTAGGG + Intronic
1062269926 9:135703709-135703731 GCCCTCCCTGGCCATTCTGCTGG + Intronic
1199687646 X:150279016-150279038 GTCCTTCTTGGCCATTCTGAGGG + Intergenic
1200829021 Y:7673007-7673029 GGCCTTGGTGCCCACTCTGGCGG + Intergenic