ID: 945251247

View in Genome Browser
Species Human (GRCh38)
Location 2:207768171-207768193
Sequence CACACGAACGGGCCCCCAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945251243_945251247 12 Left 945251243 2:207768136-207768158 CCTTCAGAATGGGCACGAAGGGC 0: 1
1: 0
2: 0
3: 12
4: 75
Right 945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945251247 Original CRISPR CACACGAACGGGCCCCCAGC GGG Exonic
900908098 1:5575019-5575041 CACATGCAAGTGCCCCCAGCTGG - Intergenic
902233370 1:15042507-15042529 CACAGGACTGGGCTCCCAGCAGG - Intronic
904172576 1:28601827-28601849 AACACCAAGGGGCCTCCAGCTGG - Intronic
1063949559 10:11209330-11209352 CACACCAACGGGCCCAGAGTCGG + Intronic
1064288705 10:14014140-14014162 CACCCGAACCTGCCCCCAGCTGG + Intronic
1076563269 10:131381337-131381359 CACTCCAACAGCCCCCCAGCGGG - Intergenic
1077030271 11:462349-462371 CACACGCAGGGGCTCCCTGCTGG - Intronic
1083764766 11:64836479-64836501 CAGACGGATGGGCCCCCAGCTGG - Exonic
1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG + Intergenic
1093497942 12:19779328-19779350 CACACTAATGGGGCCCCACCTGG + Intergenic
1102084487 12:110124653-110124675 CACCCGACCGGGCCTCTAGCGGG - Exonic
1113911574 13:113843761-113843783 CAGACAAGCAGGCCCCCAGCGGG - Intronic
1117253416 14:53956002-53956024 CACCCAATCTGGCCCCCAGCTGG - Intronic
1117455622 14:55894115-55894137 CACACGAACTAGCCCAAAGCAGG - Intergenic
1121622914 14:95362634-95362656 GTCACGAACGGGGCCCCAGTGGG - Intergenic
1122864566 14:104597666-104597688 AAGAGGAACGGGCCCTCAGCAGG + Intronic
1132032448 15:98450060-98450082 CAAGCGAGCTGGCCCCCAGCCGG + Intronic
1132069063 15:98759479-98759501 CAGAAGAACGGCCCCCCAGGGGG + Intronic
1132557488 16:578989-579011 CACTCGAACGCCCGCCCAGCCGG - Intronic
1132782469 16:1635317-1635339 CACACGCAAGGCCCCCAAGCTGG - Intronic
1133046329 16:3090301-3090323 CACAGGAAGGAGCGCCCAGCCGG + Exonic
1142236680 16:88925725-88925747 CACACGCAGGGGCTCCCGGCGGG - Intronic
1142496810 17:310376-310398 CACACACACGCGCCCCCAGCAGG - Intronic
1144852572 17:18251448-18251470 CAGATGCCCGGGCCCCCAGCGGG - Exonic
1147518653 17:41146876-41146898 CACAAGAACTGGGCCACAGCAGG - Intergenic
1152161495 17:78671194-78671216 CACACATAGGGGCCCACAGCGGG + Intergenic
1157046363 18:44105637-44105659 CACAAGAAGGGGCCCACAACTGG + Intergenic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1164305990 19:24004088-24004110 CACAGGAACTCGGCCCCAGCCGG + Intergenic
1168241382 19:55090849-55090871 GACACGCACGGCCCCCCAGCAGG + Intergenic
1202649233 1_KI270706v1_random:165802-165824 CTTATGAACGGTCCCCCAGCTGG + Intergenic
925889885 2:8425097-8425119 CACACGAATGGGCCGCCTGTGGG + Intergenic
926562638 2:14434715-14434737 CACAAGAACAGGCCCCGGGCAGG + Intergenic
927689803 2:25200433-25200455 AACACGAACAGAGCCCCAGCGGG + Intergenic
928114802 2:28539007-28539029 CACCCCAACGGGGCCCAAGCAGG + Intronic
929849330 2:45569328-45569350 CACAGGAACGGGAGACCAGCAGG - Intronic
935987471 2:108688816-108688838 CACACACAGCGGCCCCCAGCAGG + Intergenic
936126297 2:109791513-109791535 CACACACAGCGGCCCCCAGCAGG + Intergenic
936218396 2:110579955-110579977 CACACACAGCGGCCCCCAGCAGG - Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
948130591 2:235597675-235597697 CACACAGACAGGGCCCCAGCGGG - Intronic
1175390420 20:58623959-58623981 CACACTAATGAGACCCCAGCAGG - Intergenic
1181571057 22:23767992-23768014 CTCAGGAACACGCCCCCAGCGGG + Exonic
1184523588 22:45009189-45009211 CTCACGAAGGGGCCCCCTCCAGG + Intronic
1184740942 22:46428797-46428819 CTCACTCACGGGTCCCCAGCGGG + Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
954133431 3:48571199-48571221 CTCACGACCAGGACCCCAGCAGG + Intronic
985545343 5:506287-506309 CACACGAAAGGGGCCCGAGACGG + Intronic
998817497 5:146028900-146028922 AACACGAACGCGCTCCTAGCTGG + Intronic
1017964620 6:159253416-159253438 CACATTATCGGGCCCCCTGCAGG + Intronic
1019544111 7:1564998-1565020 CACAGGAGCGAGGCCCCAGCGGG - Intergenic
1028621991 7:92835770-92835792 CACACGGACGGGCGCGCTGCGGG + Intronic
1031613125 7:123850380-123850402 CACAGGAACGCACCACCAGCCGG + Intronic
1034968321 7:155404732-155404754 CACACCACGGGCCCCCCAGCGGG + Intergenic
1045028968 8:98117205-98117227 CGCACGAGCCCGCCCCCAGCGGG - Exonic
1190333751 X:49250644-49250666 CACACGCACAGCCCCCCAGTGGG - Exonic