ID: 945264956

View in Genome Browser
Species Human (GRCh38)
Location 2:207881844-207881866
Sequence GCTGCTTGGAGGCACCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945264951_945264956 0 Left 945264951 2:207881821-207881843 CCTAGTGAGGGAGGGAAGCCCTT 0: 1
1: 0
2: 2
3: 31
4: 252
Right 945264956 2:207881844-207881866 GCTGCTTGGAGGCACCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 236
945264944_945264956 26 Left 945264944 2:207881795-207881817 CCAGTGAAAATCATGGAGCTACT 0: 1
1: 0
2: 0
3: 9
4: 113
Right 945264956 2:207881844-207881866 GCTGCTTGGAGGCACCATCCTGG 0: 1
1: 0
2: 2
3: 16
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945264956 Original CRISPR GCTGCTTGGAGGCACCATCC TGG Intronic
900321915 1:2088715-2088737 GCTGCCTGGAGGCCCCTCCCAGG + Intronic
901024145 1:6270213-6270235 GCTGCGAGGAGGCAGCAGCCGGG - Intronic
901436725 1:9251088-9251110 GCTGCTTCGAGACCCCAGCCAGG - Intronic
902748168 1:18487336-18487358 GCTGGCTGGAGGGGCCATCCAGG + Intergenic
904475732 1:30763633-30763655 GCTGCTTGGAGTAACCTGCCTGG - Intergenic
905040098 1:34948539-34948561 GATGCTTGAAGGCAGCATGCTGG + Intergenic
906164419 1:43675287-43675309 GCTCCTTGAAGGCACAGTCCTGG - Intronic
907766784 1:57421048-57421070 GATGCTTGGAGCCACCCTGCAGG - Intronic
907892282 1:58647505-58647527 CCTGCTTGCAGGCAGGATCCAGG + Intergenic
909893427 1:81035833-81035855 GATGCTTGAAGGCAGCATACTGG + Intergenic
913369668 1:118083978-118084000 GCTGCTTACATGCCCCATCCTGG - Intronic
915288085 1:154865523-154865545 TCTGCTAGGAGGCATCAGCCTGG - Intronic
916864228 1:168837906-168837928 GATGCTTGAAGGCAGCATACTGG + Intergenic
917811438 1:178662204-178662226 TCTGCTTGTAGGAAACATCCAGG - Intergenic
920065439 1:203266340-203266362 GATGCTTGAAGGCAGCATGCTGG - Intronic
920458294 1:206117291-206117313 CCTGCTTGGAGGCGCGGTCCGGG + Exonic
922437011 1:225616116-225616138 GATGCTTGAAGGCAGCATGCTGG + Intronic
922705927 1:227789939-227789961 CCTGTGTGGAGGCACCATCCGGG + Intergenic
922767956 1:228165831-228165853 GCTGCTTCGAGGCGCCACTCCGG + Exonic
1064122887 10:12634783-12634805 GCCGCTGGGAGGCAACATCTCGG + Intronic
1065928872 10:30460964-30460986 GCCGCTTGGAGGCACATTCACGG - Exonic
1066659747 10:37728005-37728027 GCTCGTTGGATGCACTATCCAGG + Intergenic
1067440578 10:46307174-46307196 GCTGCTTGGTGTCACCATCCTGG - Intronic
1067478335 10:46580177-46580199 GGTGATTGGGGGCACCATCGGGG + Exonic
1067616403 10:47761610-47761632 GGTGATTGGGGGCACCATCGGGG - Intergenic
1068159600 10:53247098-53247120 TCTGCTTGGAGGCTCCATTTTGG + Intergenic
1075061539 10:119260612-119260634 GATGCTTGAAGGCAGCATGCTGG - Intronic
1075108419 10:119559129-119559151 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1075604821 10:123796996-123797018 GCAGCCTGCAGGCTCCATCCAGG + Intronic
1077469730 11:2751549-2751571 ACTGCTGGTGGGCACCATCCCGG + Intronic
1078641637 11:13102181-13102203 CCAGCTTTAAGGCACCATCCTGG + Intergenic
1079698186 11:23510449-23510471 TCTGCTAGGAGCCACCATCAAGG + Intergenic
1080860438 11:36145793-36145815 GATGCTTGAAGGCAGCATGCTGG + Intronic
1083030367 11:59585954-59585976 GATGCTTGAAGGCAGCATGCTGG + Intronic
1084617909 11:70248635-70248657 GCTGAAAGGAGGCACCATCACGG + Intergenic
1089148646 11:116347836-116347858 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1089964785 11:122647036-122647058 GCTCCTAGGAGGCTCCGTCCAGG + Intergenic
1090305855 11:125690425-125690447 TCTGCTTGGAGCCAGCAGCCTGG + Intergenic
1092519661 12:9255765-9255787 GCTTCTTGGACACACCATCCAGG + Intergenic
1092832825 12:12461764-12461786 GCAGCTTCCAGGCACCTTCCTGG - Intronic
1093859956 12:24153077-24153099 GCTGCTTGGAGCAAGCATCATGG - Intergenic
1096021842 12:48331908-48331930 GATGCTTGAAGGCAACATGCTGG - Intergenic
1096660706 12:53122539-53122561 GATGCTTGAAGGCAGCATGCTGG - Intronic
1101269680 12:103130524-103130546 GCTCCCTGGAGGAACCAACCTGG - Intergenic
1101320935 12:103672569-103672591 GGTGCTTGGAGCCATCATCCAGG - Intronic
1102089539 12:110173752-110173774 GATGCTTGAAGGCAGCATGCTGG + Intronic
1102539380 12:113607709-113607731 GGTGTTTGGAGGCATCATCTGGG - Intergenic
1103725961 12:122997491-122997513 GCTGCACGGAGGCACCATCCTGG - Exonic
1105299244 13:19117860-19117882 GCTGGTTGGGGGCACTCTCCAGG - Intergenic
1105299318 13:19118193-19118215 GCTGCTAGCAGCCGCCATCCGGG - Intergenic
1105890860 13:24681247-24681269 GCTCCTTGGAGGCATCAGTCAGG + Intronic
1106114501 13:26805878-26805900 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1106650237 13:31682671-31682693 GCTGTATGGTGGCACCATCTGGG - Intergenic
1106829640 13:33565688-33565710 CCTGTTTGGAGGCAGCGTCCTGG - Intergenic
1107644146 13:42476761-42476783 GATGCTTGAAGGCAGCATACTGG + Intergenic
1109070011 13:57753138-57753160 GCTGTTTGAAGGCAACATCTAGG - Intergenic
1110301733 13:73936693-73936715 ACTGCTTGGAGGTAACTTCCGGG - Intronic
1114170567 14:20269141-20269163 GATGCTTGAAGGCAGCATGCTGG + Intronic
1114191640 14:20443587-20443609 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1114336757 14:21698363-21698385 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1114438175 14:22725412-22725434 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1114494845 14:23125675-23125697 GAAGCTGGGAGACACCATCCAGG + Exonic
1114508126 14:23233194-23233216 GATGCTTGAAGGCAGCATGCTGG + Intronic
1117513025 14:56471865-56471887 GCTGCTTGGAGGCCACATAACGG - Intergenic
1117674096 14:58138542-58138564 GTTGCTTGGTGGCAGCAGCCTGG + Exonic
1118637811 14:67763981-67764003 GCTGCTGGGTGGAAGCATCCTGG + Intronic
1118731204 14:68668192-68668214 GCTGCTTCGAGGAAGTATCCTGG - Intronic
1119821157 14:77616949-77616971 CCTGATTGGAGGCCGCATCCAGG + Intergenic
1119868394 14:77993231-77993253 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1121598615 14:95185749-95185771 TCTGCTTGGAGACACCTTCCTGG - Exonic
1122764331 14:104055053-104055075 GGTTCTTGGAGGCACCATGGTGG + Intergenic
1122929611 14:104927317-104927339 TCTGCTTGGAGGCCCCCTCAAGG - Intronic
1123123138 14:105927281-105927303 GCAGCCTGCAGGCACCAGCCGGG + Intronic
1124375238 15:29125422-29125444 GTTGCCTGGAGGTACCCTCCTGG - Intronic
1125032341 15:35085330-35085352 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1126125582 15:45292616-45292638 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1127477495 15:59348455-59348477 GCTGCTTTTAGGAACCATCCAGG + Intronic
1127653777 15:61036161-61036183 TCTCCTTGGAGGCAGCAACCAGG + Intronic
1129444712 15:75608816-75608838 ACTGCATGTAGACACCATCCTGG - Intronic
1131546866 15:93322845-93322867 GCTGCTTGGATGCCCCTTCCTGG + Intergenic
1132670010 16:1098680-1098702 GCTGGCTGGTGGCACCAGCCTGG - Intergenic
1133027615 16:2995535-2995557 GCTGCTGGGAGGAAGCCTCCAGG + Intergenic
1134017889 16:10901985-10902007 GGTGCTTGGAGGGGCCTTCCTGG - Intronic
1134248101 16:12555023-12555045 GCTGCTCGGTGGCACCAGGCAGG - Intronic
1137386797 16:48049477-48049499 GATGCTTGGAAGCACCTGCCTGG + Intergenic
1139563663 16:67759394-67759416 GCTGCCTGGAGGCACCCTATAGG + Intronic
1139589992 16:67928229-67928251 GCTCCCTGGAGGCACCATGAAGG - Exonic
1139740468 16:69031123-69031145 GCTGCTTTGGGGCACCTTCCTGG + Intronic
1143180509 17:4981415-4981437 GGTGCTTGGAGGAGCCATCAAGG - Intronic
1143683357 17:8494125-8494147 GATGCCTGGAGGCTCCAGCCTGG - Intronic
1146466406 17:33090087-33090109 TCTGCCTCGAGGCACCATGCGGG + Intronic
1147622461 17:41876700-41876722 GATGCTTGAAGGCAGCATGCTGG + Intronic
1148682560 17:49483087-49483109 GCTGCTGGGAGGCAGCCCCCGGG - Intergenic
1148849495 17:50547907-50547929 GCTGCTTGGAGGCATCTCTCTGG - Intronic
1149992739 17:61391879-61391901 CCTGCCTTGAGGCACCATTCTGG - Intronic
1151675655 17:75596100-75596122 GCTTCCTGGAGGCAGCAGCCTGG + Intergenic
1152287745 17:79422414-79422436 GCTTCCTGGAGGCACCGGCCTGG - Intronic
1152672838 17:81618991-81619013 GATGCTTGAAGGCAGCATGCTGG + Intronic
1152730552 17:81967652-81967674 GCTGCATGTTGGCACCAGCCGGG - Intergenic
1153243290 18:3050202-3050224 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1153785252 18:8528729-8528751 GCTGGCTGGAGGCCCCATTCGGG - Intergenic
1153852924 18:9113456-9113478 GCTGGCAGGAGGCAGCATCCTGG + Intronic
1154416313 18:14177790-14177812 GCGGGTTGGGGGCACTATCCTGG + Intergenic
1154420903 18:14225445-14225467 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1155096297 18:22559529-22559551 GCCGCCTGGCGGCTCCATCCCGG + Intergenic
1155385821 18:25276075-25276097 TCTGCTTGGTGCCACCATACAGG + Intronic
1156541431 18:37915401-37915423 GCTGCTTATAAGCACCATCATGG - Intergenic
1157611303 18:48957863-48957885 GCTGATTGGAGTCAGGATCCAGG + Intergenic
1159570178 18:70103544-70103566 GATGCTTGAAGGCAGCATGCTGG + Intronic
1160353124 18:78201918-78201940 GGAGCATGGAGGCCCCATCCAGG - Intergenic
1160665196 19:324886-324908 GCAGCTTGGCTGCACCTTCCTGG + Intronic
1160723931 19:609247-609269 GCTGCCGGGGGGCACCGTCCTGG + Intronic
1160906287 19:1453177-1453199 GCTGCCGGGGGGCACCACCCCGG - Intronic
1160985102 19:1834957-1834979 GGTGCTGGAAGGCAGCATCCTGG + Intronic
1161454589 19:4363647-4363669 GCTCCCTTGAGGCACCACCCCGG + Intronic
1161685998 19:5702805-5702827 GATGCTTGAAGGCAGCATGCTGG + Intronic
1161790430 19:6356259-6356281 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1163896326 19:20063729-20063751 GATGCTTGAAGGCAACATGCTGG - Intergenic
1164217104 19:23160447-23160469 GATGCTTGAAGGCAGCATACTGG - Intergenic
1165757921 19:38304847-38304869 GCTGCTTGGAGCCAGCAGCGTGG - Exonic
1166938158 19:46347351-46347373 GCTCCTTGGCAGCGCCATCCTGG - Intronic
1168707018 19:58476160-58476182 GTTGCTTGGAGGCCGCTTCCCGG - Exonic
927215509 2:20666234-20666256 GAAGCTCGGAGGCGCCATCCCGG + Intergenic
927453841 2:23232347-23232369 GGTGCTGGGAGGCACCAGCATGG + Intergenic
928751470 2:34475235-34475257 GTTGCTTGGAGGCAACACCACGG + Intergenic
929445251 2:41995967-41995989 GATGCTTGAAGGCAGCATGCTGG + Intergenic
931480096 2:62630994-62631016 GATGCTTGAAGGCAGCATGCTGG + Intergenic
932929208 2:76013839-76013861 GCTGCTAGGGTGCACAATCCTGG + Intergenic
935806607 2:106754652-106754674 ACTGCCTGGAGTCACAATCCAGG - Intergenic
936288186 2:111197838-111197860 ACTGCTTGGAGGCTCCAGCCCGG + Intergenic
936546673 2:113395792-113395814 GATGCTTGAAGGCAACATGCTGG + Intergenic
937382110 2:121387801-121387823 GGAGTTTGGTGGCACCATCCTGG + Exonic
942332005 2:174836170-174836192 ACTGCTTGGAGGCAGTTTCCAGG - Intronic
945264956 2:207881844-207881866 GCTGCTTGGAGGCACCATCCTGG + Intronic
946109911 2:217405726-217405748 GCTGCATTGTGGCACCACCCAGG - Intronic
946125833 2:217561901-217561923 GCAGCTTGGGGTCACCATCATGG + Intronic
1169082416 20:2805484-2805506 GCAGCTTGTGGGCACCATTCTGG + Intergenic
1169167912 20:3440639-3440661 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1172195149 20:33086380-33086402 GCTGGTCGAAGGCCCCATCCTGG - Intronic
1172485962 20:35298064-35298086 GGTGCTTGGAGGTCCCTTCCTGG + Intergenic
1172918277 20:38460852-38460874 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1173808005 20:45938836-45938858 GCTGCTGTGTGGCACCATGCTGG + Intronic
1174722333 20:52826416-52826438 GCAGCAAGGAGGCACCATCTTGG - Intergenic
1175788084 20:61724255-61724277 CCTGCTTCAAGGCAGCATCCAGG + Intronic
1175894875 20:62331560-62331582 GCTGCTTGGTGCCACCAGGCCGG + Intronic
1176297332 21:5081093-5081115 GCTGCCTGGTGCCACCACCCAGG + Intergenic
1176857025 21:13981500-13981522 GCAGGTTGGGGGCACTATCCTGG - Intergenic
1179859697 21:44180855-44180877 GCTGCCTGGTGCCACCACCCAGG - Intergenic
1180993676 22:19953855-19953877 CCTGCTTGGAGGCCCCCTGCAGG - Intronic
1181065907 22:20305950-20305972 GCTCCTTGAAGGCCTCATCCTGG + Intergenic
1182199529 22:28554161-28554183 GATGCTTGAAGGCAGCATGCTGG + Intronic
1182685708 22:32120756-32120778 TCTGCTTGGGGGCGCTATCCCGG - Intergenic
950044179 3:9939539-9939561 GATGCTTGAAGGCAGCATGCTGG - Intronic
950429923 3:12944833-12944855 GCTGCTGGGAGGCACCGTCAGGG + Intronic
950436057 3:12980837-12980859 GCTGCGTGGATGCTCCTTCCTGG + Intronic
950948931 3:16979544-16979566 GATGCTTGAAGGCAGCATGCTGG - Intronic
952706254 3:36380639-36380661 GCTGCTCGGAGGGATCATCGTGG - Exonic
953082464 3:39633676-39633698 GCTGCATGGAGGCCCCATGCTGG - Intergenic
953084979 3:39656424-39656446 GATGCTTGAAGGCAGCATGCTGG + Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955403669 3:58611447-58611469 CCTGATTGGAGGAGCCATCCAGG - Intronic
955882814 3:63565715-63565737 GCTGCAATGAGGCACCATCTTGG + Intronic
958510070 3:95036940-95036962 GCAGCATGAAGGCACAATCCAGG - Intergenic
958691919 3:97480439-97480461 GATGCTTGAAGGCAGCATGCTGG - Intronic
959527575 3:107394753-107394775 GCTGCTCAGAGGCACAGTCCTGG + Intergenic
960864142 3:122183628-122183650 GCTGCTTGGAGGCCCGGACCTGG - Intergenic
961787858 3:129358264-129358286 GCAGCTGGGAGCCACCACCCTGG + Intergenic
963770440 3:149381187-149381209 GATGCTTGAAGGCAGCATGCTGG + Intergenic
964766110 3:160179360-160179382 GATGCTTGAAGGCAGCATGCTGG + Intergenic
968289353 3:197526648-197526670 GCTGCTTGGAGTCACCTTAAGGG - Intronic
970251745 4:14123891-14123913 GCTGCTAGTAGCCACCCTCCTGG - Intergenic
971093523 4:23372323-23372345 GATGCTTGAAGGCAGCATGCTGG + Intergenic
971594691 4:28514404-28514426 GATGCTTGAAGGCAGCATGCTGG - Intergenic
974549255 4:63349728-63349750 GCTGCGTGTAGGCACCACCAGGG - Intergenic
974919366 4:68219456-68219478 GCAACCTGGAGCCACCATCCTGG + Intergenic
975686276 4:76918651-76918673 GATGCTTGAAGGCAGCATGCTGG + Intergenic
975908978 4:79246161-79246183 GATGCTTGAAGGCAGCATGCTGG + Intronic
982001086 4:151021910-151021932 TCTGCTTGAAGTCAACATCCTGG - Intergenic
982709489 4:158745991-158746013 GATGCTTGAAGGCAGCATGCTGG - Intergenic
982821780 4:159949644-159949666 GCTGCTTGGTAGCACCATGTTGG - Intergenic
984243033 4:177240943-177240965 GCAGCTTGGAGGCAGAATCCTGG - Intergenic
986992407 5:13569733-13569755 GCTGGTTGAAGGCAAGATCCAGG - Intergenic
992543384 5:77785898-77785920 GTGGATTGGAGGCTCCATCCTGG + Intronic
993172467 5:84436271-84436293 GCAGCTTGGAGTCAGCATCACGG + Intergenic
993633547 5:90317163-90317185 GCAGCATTGAGGCACCATTCTGG - Intergenic
993860109 5:93125604-93125626 GGGGCTTGGAGGCTCCCTCCAGG - Intergenic
994930198 5:106172997-106173019 GCTGCTTGGAGGCTGCATTTAGG - Intergenic
995142658 5:108749765-108749787 GATGTTTGGAGGCACCTTCAGGG + Intronic
998020811 5:138768624-138768646 GCTGTTTGCAGGCACAATCACGG + Intronic
998431533 5:142074871-142074893 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1000635530 5:163639976-163639998 GCTGCATGGAGACAGCCTCCAGG - Intergenic
1001704293 5:173730670-173730692 GCTGCTTGGTGGGGCCTTCCTGG + Intergenic
1005711027 6:28502903-28502925 GATGCTTGAAGGCAGCATACTGG + Intergenic
1006378977 6:33687005-33687027 GCAGCTTGGAGGCATTGTCCTGG - Exonic
1006646664 6:35519659-35519681 CCTGCTTGGAGGCTCCAGCCTGG + Intergenic
1007792265 6:44317226-44317248 GATGCTTGAAGGCAGCATGCTGG + Intronic
1008909763 6:56720561-56720583 GATGCTTGAAGGCAGCATGCTGG - Intronic
1009042124 6:58191220-58191242 GATGCTTGAAGGCAGCATACTGG + Intergenic
1009217960 6:60945452-60945474 GATGCTTGAAGGCAGCATACTGG + Intergenic
1010192017 6:73205319-73205341 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1013190991 6:107803837-107803859 GATGCTTGAAGGCAGCATGCTGG + Intronic
1013326326 6:109047882-109047904 GATGCTTGAAGGCAGCATGCTGG + Intronic
1018276100 6:162133208-162133230 GCTGCCTGGAGGCACCATGAGGG + Intronic
1019651681 7:2162375-2162397 GATGCTTGAAGGCAGCATGCTGG + Intronic
1020070495 7:5223858-5223880 GCTCCCTGGAGGCACCATTCAGG - Intronic
1021275655 7:18647856-18647878 GCAGTATGGAGGCAGCATCCCGG + Exonic
1021803701 7:24333990-24334012 GCTGCTTGTAGGAATCACCCAGG + Intergenic
1022412445 7:30149435-30149457 GCTGGTGGGAGGCACCTTCCCGG + Intronic
1023897004 7:44442403-44442425 GCTGTTTGGGGGCACCAGCATGG + Intronic
1029129472 7:98319073-98319095 GCTGCCTGGCTGCACCCTCCCGG - Intronic
1030796107 7:113790042-113790064 GCTGCAGGGAGGCACCACCTTGG - Intergenic
1031763000 7:125737661-125737683 GCGGCTTGAAGTCACCATCACGG - Intergenic
1033608850 7:142946571-142946593 GCCTCTAGGAGGCATCATCCTGG + Intronic
1034194725 7:149237671-149237693 GCTTCTGGGAGGCAACATGCAGG - Intergenic
1034211828 7:149370447-149370469 ACTGATTGGTGACACCATCCCGG + Intergenic
1034804097 7:154073240-154073262 GCTGCTTTCAGGCACCGTCATGG + Intronic
1037916212 8:22774978-22775000 GCTCCTGGGTGACACCATCCTGG + Intronic
1039183955 8:34895693-34895715 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1040549588 8:48427930-48427952 TCTGCATGGAGGCCCCGTCCAGG - Intergenic
1042196309 8:66233225-66233247 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1042290582 8:67166931-67166953 GATGCTTGAAGGCAGCATGCTGG - Intronic
1042365752 8:67934553-67934575 GCTTCATGGAGGCGCCAGCCTGG - Intergenic
1044086860 8:87953097-87953119 GCTGCTTTCAGGAACCATTCAGG + Intergenic
1044697382 8:94936789-94936811 GCTCCCTGGAGGTGCCATCCTGG + Intronic
1046599813 8:116302943-116302965 GCTGCCTGCAGGCTCCATTCTGG - Intergenic
1046634825 8:116662746-116662768 GCTCCTGGCAGGCACCATCAAGG + Intronic
1047514422 8:125541260-125541282 GCTGGGTGGAGGCAACACCCAGG + Intergenic
1048670375 8:136712550-136712572 GCAGCTTGGAGTCGCCATCATGG + Intergenic
1049604976 8:143525178-143525200 GCTGCTGGGAGGTGCCACCCAGG - Intronic
1049943671 9:573960-573982 GTTGCTTGGAGGAGCCAACCAGG + Intronic
1050521963 9:6510208-6510230 GCTTCTTAGAGGGACCATGCAGG + Intergenic
1050782818 9:9359822-9359844 GCTGCGTGGAGGCAATATGCTGG + Intronic
1053218772 9:36294187-36294209 GCTGCTTGGGGAAACCATGCGGG + Intronic
1053221925 9:36319431-36319453 CCTGCTTGGAAGTCCCATCCTGG + Intergenic
1056097954 9:83273418-83273440 GATGCTTGAAGGCAGCATACTGG + Intronic
1056221245 9:84452506-84452528 GCTGCTTCAAGTCACCATTCAGG - Intergenic
1056818102 9:89816312-89816334 GCAGCTTGCTCGCACCATCCTGG - Intergenic
1058375564 9:104317204-104317226 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1058390344 9:104489425-104489447 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1058663079 9:107283614-107283636 GCTGCGCGGCGGCACCATGCAGG + Exonic
1058680734 9:107438244-107438266 GCAGCCTGGAGGCAACATCAGGG - Intergenic
1059879738 9:118677549-118677571 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1061189218 9:129071819-129071841 GATGCCTGGAGGCAGCCTCCAGG + Exonic
1061645927 9:132001871-132001893 GCTGCATGCAGGAATCATCCTGG + Intronic
1062266560 9:135689126-135689148 GGTGTCTGGAGGCACCATCCAGG - Intergenic
1062562082 9:137146201-137146223 GCTCCCTGGAGGCCCCAGCCGGG + Intronic
1203787015 EBV:133759-133781 GGTGCTTGAGGGCACCACCCAGG + Intergenic
1189744892 X:44158926-44158948 GCTGCTGGGAGTCCCCTTCCTGG + Intronic
1191995357 X:67089388-67089410 ACTGCTGGGATGCACCATCTAGG - Intergenic
1192237647 X:69306098-69306120 GCTGCTGGGAGGCTCCGCCCGGG - Intergenic
1195257419 X:103104056-103104078 GATGCTTGAAGGCAGCATGCTGG - Intergenic
1197101084 X:122655858-122655880 GATGCTTGAAGGCAGCATGCTGG + Intergenic
1197652692 X:129083070-129083092 GATGCTTAGAGCCCCCATCCTGG - Intergenic
1197807500 X:130411851-130411873 GCTTCTCGGAGGCACTCTCCTGG + Intronic
1199836658 X:151599029-151599051 GATGCTTGAAGGCAGCATACTGG - Intronic