ID: 945265987

View in Genome Browser
Species Human (GRCh38)
Location 2:207891925-207891947
Sequence CTCAGGTGACATTTTATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945265984_945265987 -7 Left 945265984 2:207891909-207891931 CCTGAGAACTAAGTAACTCAGGT 0: 1
1: 0
2: 1
3: 10
4: 100
Right 945265987 2:207891925-207891947 CTCAGGTGACATTTTATTTGGGG 0: 1
1: 0
2: 0
3: 25
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945265987 Original CRISPR CTCAGGTGACATTTTATTTG GGG Intronic
900770065 1:4533836-4533858 TTCATGTGAGATTTTGTTTGGGG + Intergenic
901696462 1:11011801-11011823 CTTGGGTGACATTTTTTTGGGGG + Intergenic
903719697 1:25395610-25395632 CTCTGGTGACATTTTCTTCCTGG + Intronic
907990175 1:59573720-59573742 CTCAAGTGGGATTTTATATGGGG - Intronic
909912970 1:81283072-81283094 TTCTGTTGACAGTTTATTTGAGG + Intergenic
911572145 1:99530594-99530616 CTCAGGTGCTATTATTTTTGGGG - Intergenic
912760027 1:112358705-112358727 CTCAAGAGACATTTCACTTGCGG + Intergenic
912851796 1:113132669-113132691 CACAGGGGCCATTTTCTTTGAGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
916350219 1:163841076-163841098 CTCTGGTGATAGTTTATCTGGGG - Intergenic
916376319 1:164157434-164157456 CAGAGGTTACATTTTGTTTGTGG - Intergenic
916919158 1:169444391-169444413 CTCAGGTGGCATTTTTATTAGGG + Intronic
917527321 1:175800427-175800449 ATCACCTGACATTTTATGTGAGG - Intergenic
918763032 1:188439146-188439168 CTTTGGTGACATTTTGTTTCTGG + Intergenic
923914500 1:238486781-238486803 GTCAGTTGACAGTTTCTTTGGGG + Intergenic
924866630 1:247989771-247989793 CTCAGATGACAGTTGATTTCAGG - Intronic
1063179815 10:3588055-3588077 CTCAGGTGGGATTTTATTCAAGG + Intergenic
1064023939 10:11831710-11831732 TTCAGGTGAGATTTTACTTTAGG + Intronic
1064740280 10:18426152-18426174 CCCTGCTGACATTTTGTTTGGGG + Intronic
1064801799 10:19083589-19083611 TTCAGATGGCATTTTAATTGTGG + Intronic
1066173150 10:32873689-32873711 TTCATGTGACATTCTTTTTGTGG + Intronic
1066554658 10:36598393-36598415 CTTTGGTTACATTTTATTTTGGG - Intergenic
1067280904 10:44871985-44872007 CTCAGGTGCCAATTTATGTCAGG - Intergenic
1068132183 10:52908644-52908666 CTCAGGTGTCAGATTATTTGAGG + Intergenic
1068330831 10:55565837-55565859 GTCAGGAGATATTTTATTAGTGG - Intronic
1070148037 10:73788896-73788918 CAAAGGAGACATTGTATTTGGGG + Intronic
1071131748 10:82402265-82402287 CAGAAGTGACATTCTATTTGGGG - Intronic
1071280714 10:84100241-84100263 CTCACGTGACTTTTATTTTGGGG + Intergenic
1071735914 10:88300527-88300549 CTCAAGTGACATCTTCTTTTAGG + Intronic
1072522403 10:96240014-96240036 AGAAGGTGACATTTAATTTGAGG - Intronic
1074835910 10:117293437-117293459 CTCAGGTGATATTATATTCCAGG - Intronic
1074961745 10:118452366-118452388 TTCAAGTGACTTTTTATTTCAGG - Intergenic
1075111783 10:119593286-119593308 CTCATTTGACATTTATTTTGGGG - Intronic
1079951607 11:26812286-26812308 CTTCTGTGACATTTTCTTTGTGG + Intergenic
1079983646 11:27177821-27177843 TTCATGTCACATTTTCTTTGGGG + Intergenic
1080775178 11:35379463-35379485 CACAGGTGCCATGTTCTTTGTGG - Intronic
1080819763 11:35794167-35794189 CTCAGCTGACATTTCATCTGAGG + Intronic
1085084500 11:73657732-73657754 CTCAGGTCCAATTTTATTGGTGG - Intronic
1087605740 11:100375748-100375770 CTAAGATGACATTTGCTTTGAGG + Intergenic
1089089668 11:115860483-115860505 ATCTGATGACATTTTAGTTGTGG + Intergenic
1094082259 12:26550581-26550603 CTCAGGTGGCATTCTTTTAGTGG + Intronic
1094250788 12:28358465-28358487 CTGAGCTGACATTTTATATAAGG + Intronic
1094357798 12:29596855-29596877 CTAAAGTGACTTGTTATTTGTGG + Intronic
1095580027 12:43787289-43787311 ATCAAGGGATATTTTATTTGTGG - Exonic
1096945021 12:55395447-55395469 CTCAGGATACATTTTAGATGAGG - Intergenic
1100544478 12:95588331-95588353 ATCATCTGAGATTTTATTTGGGG - Intergenic
1104317437 12:127717022-127717044 CTCAGATGACATTTTATGTTGGG + Intergenic
1106064875 13:26336524-26336546 CTCAGATGGCATTTTCTCTGAGG + Intronic
1107483685 13:40806400-40806422 ATCAGTTGACTTTGTATTTGAGG + Intronic
1107794190 13:44032897-44032919 CTCAGCTGGCATTGTATATGAGG - Intergenic
1108412983 13:50168944-50168966 CTCAGCTGACAGTTGACTTGTGG - Intronic
1110522433 13:76496401-76496423 ATCTGTTGACATTTTAATTGAGG + Intergenic
1110933443 13:81252156-81252178 CTCAGTAGACATTTTTTTTTTGG + Intergenic
1111677140 13:91400485-91400507 ATAAGGCGATATTTTATTTGGGG - Intronic
1112638259 13:101241987-101242009 CTCACGTCACATTTAATTTTTGG + Intronic
1114990212 14:28277297-28277319 CACCTGTGACAATTTATTTGTGG + Intergenic
1115451851 14:33557068-33557090 CTCAGGAGACATCTTGTTTGAGG + Intronic
1116593045 14:46804654-46804676 CTCAGTTGACTTTATATGTGTGG + Intergenic
1120259303 14:82161585-82161607 CTCAGATGACATTTCTTTTTAGG - Intergenic
1121263599 14:92584215-92584237 CTCAGGTGACATGCCATCTGAGG + Intronic
1121479649 14:94254582-94254604 CTCAGCTGAATTTTTACTTGAGG - Intronic
1121601142 14:95203860-95203882 CGCTGGTGACATTTTTTTGGTGG - Exonic
1125036397 15:35129529-35129551 CTCACCAGACATTTTTTTTGCGG + Intergenic
1126587727 15:50306200-50306222 CTGAGGTGGCAGATTATTTGAGG - Intronic
1127075583 15:55322182-55322204 CTCAAGTGATACTTTTTTTGCGG - Intronic
1128665104 15:69532000-69532022 CTTAGATGGCATGTTATTTGGGG - Intergenic
1129695325 15:77737745-77737767 ATCAGGTGACATTTTATCTCTGG + Intronic
1130756766 15:86772401-86772423 ATCAGTTTACATTTTATTTGTGG + Intronic
1131380966 15:91963496-91963518 ATCAGATGAAATGTTATTTGGGG - Intronic
1133244169 16:4436331-4436353 CTCACATGACAGTTGATTTGAGG + Intronic
1133683706 16:8145997-8146019 CTTATATGGCATTTTATTTGAGG + Intergenic
1134433043 16:14229345-14229367 CTCATTTTTCATTTTATTTGGGG + Intronic
1140990257 16:80204078-80204100 CTCAGGTGACATTAGCTTTGGGG - Intergenic
1147552666 17:41455416-41455438 CTCAGCTGCCATTGTAATTGGGG + Intergenic
1149594470 17:57856162-57856184 CTCAGGTGAGATTTAATTGAAGG - Intergenic
1150695575 17:67402174-67402196 TTCCAGTAACATTTTATTTGTGG + Intronic
1152010616 17:77711353-77711375 CTCACGTGGCTTTTTATCTGTGG - Intergenic
1155576299 18:27251288-27251310 ATCAGGTGCTATTTTAATTGCGG + Intergenic
1156640363 18:39088158-39088180 CTAAGGTGATATATTATTTAGGG + Intergenic
1157260758 18:46174057-46174079 CTCTGGTGACATTTTCTTGGGGG + Exonic
1157806217 18:50659606-50659628 CTCAGGTAACAGCTTAGTTGAGG - Intronic
1158836420 18:61334929-61334951 GTCCGGGGACATTTCATTTGAGG - Intronic
1159195989 18:65115269-65115291 CTCAGGTGACAAAATATTTTTGG - Intergenic
1159603500 18:70451448-70451470 TTAACGTCACATTTTATTTGGGG + Intergenic
1160255486 18:77244818-77244840 CTAAGGGGACATTTTAACTGGGG + Intergenic
1160522071 18:79513473-79513495 TTAAAGTGACATTTTGTTTGAGG - Intronic
1168005567 19:53483833-53483855 CTCAGGTGAGATGATATTTTTGG + Exonic
1168557186 19:57352964-57352986 CTCAGTTGTCATCTTAGTTGAGG + Intronic
926067445 2:9854918-9854940 GCCATGTAACATTTTATTTGGGG + Intronic
926563365 2:14442210-14442232 GTGAAGTGACATCTTATTTGTGG - Intergenic
927276770 2:21268558-21268580 ATCAGGGCACATTTTAGTTGTGG - Intergenic
928424751 2:31168714-31168736 CTCAGGTGAGACTTCATGTGAGG + Intergenic
928549788 2:32358447-32358469 CGGAGATGACATTTCATTTGTGG + Intronic
929636480 2:43527135-43527157 CTCAGCAAACATTTTATTTTAGG - Intronic
930182248 2:48372167-48372189 ATGAGGTCACATTTTACTTGGGG + Intronic
930506778 2:52292336-52292358 CACAAGTAACAATTTATTTGGGG - Intergenic
931574993 2:63709401-63709423 CATATTTGACATTTTATTTGGGG + Intronic
933675951 2:85057754-85057776 ATCAAGTCACATTTTATTCGAGG - Exonic
933822049 2:86122096-86122118 CTCATGTGACATTTTTCATGAGG + Intronic
936691460 2:114894291-114894313 CTCTGGTAACAATTTATTTCTGG + Intronic
936889719 2:117354984-117355006 CTCAGATGACATTCTAGTGGAGG + Intergenic
936896798 2:117436737-117436759 CTCAGGAGACAACTGATTTGAGG - Intergenic
938168498 2:129054552-129054574 ATCAGGTGGCATTTTATTTCAGG + Intergenic
942058734 2:172208326-172208348 CACAGGTGACATCTTGTATGAGG + Intergenic
942659112 2:178245673-178245695 ATCAGATGACATGTTATATGTGG - Intronic
943426529 2:187743964-187743986 CTCAAGTGACCATTTATGTGTGG - Intergenic
945265987 2:207891925-207891947 CTCAGGTGACATTTTATTTGGGG + Intronic
946027526 2:216680806-216680828 CTCAGGTTGAATTTTATTTAGGG - Intronic
948118715 2:235513192-235513214 CTCAGGTCACGTTTTAACTGAGG + Intronic
1170024200 20:11871335-11871357 CTCTGTAGACATTTTATTTCAGG + Intergenic
1172001203 20:31778770-31778792 CTTCCGTGACATTTCATTTGGGG + Intronic
1173104667 20:40122603-40122625 CCCAGCAGACATTTTATTTGGGG - Intergenic
1174114636 20:48218543-48218565 TTGAGCTGACATTGTATTTGAGG - Intergenic
1174501338 20:50987239-50987261 CGGAGGTGACATTTGAGTTGAGG + Intergenic
1174648958 20:52108402-52108424 ATCAGTTGTCATTATATTTGTGG - Intronic
1174860042 20:54082761-54082783 TTAATGTTACATTTTATTTGGGG - Intergenic
1175020743 20:55846193-55846215 CTCTGGTAACACTTTATTTGTGG + Intergenic
1178950579 21:36981990-36982012 CTCATTTGAAATTTTCTTTGTGG - Intronic
1179234688 21:39535393-39535415 CACAGGTGACAATTAATTAGTGG - Intergenic
1181410930 22:22718845-22718867 TTCATGTTACAGTTTATTTGTGG - Intergenic
1182905378 22:33931364-33931386 CTGGGGTGATATTTCATTTGAGG - Intergenic
1184197097 22:42937233-42937255 CTCAGGTGTCACCTTCTTTGGGG - Intronic
949922997 3:9018552-9018574 CTGGGGTGACATGATATTTGTGG + Intronic
951632633 3:24738096-24738118 CTCAGGAGACATCTTGGTTGTGG + Intergenic
952003076 3:28809065-28809087 CACAGGGGGCATTTTTTTTGGGG + Intergenic
952113806 3:30155896-30155918 CTGAGGAGACCTTTTATTAGGGG + Intergenic
952909711 3:38172722-38172744 CTAAGGTGACATTTTCTATGAGG + Intronic
954475330 3:50738760-50738782 GTAAAGTGACATTTTATTTAAGG - Intronic
957877543 3:86168533-86168555 CTCACTGAACATTTTATTTGTGG - Intergenic
957958380 3:87218733-87218755 CTTAATTGACATTTAATTTGGGG - Intergenic
958066129 3:88546323-88546345 CTCAGGTGATTTTTATTTTGGGG + Intergenic
959175936 3:102910789-102910811 CTCAGGTGGCTATTTATTTTGGG - Intergenic
959291492 3:104480071-104480093 CTCTGTTGACAGTTTTTTTGTGG - Intergenic
960736144 3:120782810-120782832 CTCAGGAAACAGTTTATTTTGGG + Exonic
967417320 3:189233481-189233503 CTCAGGTGCCTTTTTATCTGGGG + Intronic
968160357 3:196421827-196421849 CTCAGGTGACTAATGATTTGGGG - Intronic
968533232 4:1107025-1107047 CTCAGTTGACATTATATTTTGGG - Intronic
971110486 4:23579859-23579881 AACATGTGATATTTTATTTGTGG - Intergenic
971431409 4:26571886-26571908 CTCACGTGACCTTTTACCTGTGG - Intergenic
973258198 4:48134636-48134658 CTCAGCAGACACTTTATTTGGGG + Intergenic
974136238 4:57821924-57821946 TTCAGTTGAGATTTGATTTGGGG + Intergenic
977088078 4:92630453-92630475 CTCAAGTGTCATTTTCTTTAGGG + Intronic
977408825 4:96635747-96635769 CTCATGATACATTTTATTTCAGG + Intergenic
978937217 4:114392568-114392590 CACAGGTGACATCTCATGTGGGG - Intergenic
979408948 4:120350487-120350509 CTCATGAGATACTTTATTTGTGG - Intergenic
980258898 4:130421854-130421876 CTTAGGTGACATTAATTTTGGGG + Intergenic
980872826 4:138629480-138629502 CAAAGCTGACATTTTGTTTGTGG - Intergenic
982104852 4:152002956-152002978 CCCAGGTGAAATTTTACTGGAGG - Intergenic
984690769 4:182723356-182723378 CCCATGTAATATTTTATTTGTGG - Intronic
984798030 4:183684202-183684224 CTTAGGTGACTTTTCATTCGCGG - Exonic
986028192 5:3870767-3870789 CTCCAGTTACAATTTATTTGTGG - Intergenic
986609276 5:9550818-9550840 CTCAGGAGACATTTTACTTTTGG - Intergenic
986869970 5:12034384-12034406 CTCAGATGAAATTTTCTTTATGG + Intergenic
986987723 5:13517802-13517824 ATTAGGTGACATTTGATTTAGGG + Intergenic
987294692 5:16539400-16539422 CTCTGGTGACAGCTTATTTCTGG - Intronic
987831218 5:23098004-23098026 TTTATATGACATTTTATTTGGGG + Intergenic
988117438 5:26914579-26914601 ATTAGATGACATTTCATTTGAGG + Intronic
991436135 5:66597963-66597985 TTAAGGTGATGTTTTATTTGTGG - Intronic
992123092 5:73614563-73614585 CTCAGGAGTCATATTTTTTGTGG - Intergenic
993189703 5:84666589-84666611 CTGAGCTTACATTTTATTGGAGG + Intergenic
994858470 5:105156998-105157020 CTCAGGTGACATGATAGCTGCGG - Intergenic
998908793 5:146935612-146935634 CTGAAGTGGCATTTTATCTGAGG + Intronic
999609006 5:153349366-153349388 TGGAGGTGACATTCTATTTGGGG + Intergenic
999651800 5:153775270-153775292 ATCAGGTGACATTTTAACTGAGG - Intronic
1000257277 5:159551912-159551934 TTCATGTAACTTTTTATTTGTGG + Intergenic
1002974141 6:2057637-2057659 TTAAAGTGACACTTTATTTGAGG - Intronic
1003215736 6:4108897-4108919 CCCAGTTGTCTTTTTATTTGGGG + Intronic
1004373679 6:15074059-15074081 ATCACGTGACATTTTATTATGGG - Intergenic
1005040752 6:21597387-21597409 ATCAGATGCCATTTTATATGTGG + Exonic
1005173562 6:23016794-23016816 GTCAGGTGTCATTTTATTCTTGG + Intergenic
1005811516 6:29519619-29519641 CTCAGGTGCCATGTAATTTTGGG + Intergenic
1009896997 6:69763963-69763985 CTCAGGATAAATTTTACTTGTGG + Intronic
1010424826 6:75717523-75717545 CCCATGTGAAATTTTATTTTTGG + Exonic
1010895894 6:81363458-81363480 ATCAGGTCACGTTTTATTTAAGG - Intergenic
1010940336 6:81909629-81909651 TTCAGGTGATGTTTTATGTGTGG - Intergenic
1011535189 6:88369330-88369352 CTCAGGTGACAGTCCCTTTGGGG - Intergenic
1011908113 6:92398601-92398623 CTCAGCTGAAATTTTCTTTATGG + Intergenic
1013699227 6:112743442-112743464 CTAAGCTGACACTTTAATTGTGG + Intergenic
1013702397 6:112789088-112789110 CTCATCTTGCATTTTATTTGAGG - Intergenic
1015150423 6:130031006-130031028 CCCATGTGACCTTGTATTTGTGG + Intronic
1015906623 6:138123590-138123612 CTCAGATGACATTTCTCTTGAGG - Intergenic
1016377122 6:143432995-143433017 CACAGGTTATATTTTATTTGGGG - Intronic
1018612487 6:165660049-165660071 CTCAGTTGACCTTTGATTTGGGG - Intronic
1019341676 7:511513-511535 CCCAGGTGACATTTGCTGTGGGG - Intronic
1021169512 7:17381826-17381848 CAGAGGTGACATTTGAATTGAGG - Intergenic
1022237119 7:28473019-28473041 GACAGGTGACATTTAGTTTGAGG - Intronic
1022851114 7:34263309-34263331 CTCAGTAGACTTTTCATTTGTGG - Intergenic
1023505817 7:40898917-40898939 TCCAAGTGACATTTTGTTTGAGG - Intergenic
1025040442 7:55638957-55638979 CTCTGTTTACATTTTACTTGTGG + Intergenic
1027241244 7:76330778-76330800 CCCAGGGAACATGTTATTTGTGG + Intronic
1028832428 7:95342364-95342386 CTCATGTGACCTTTGACTTGGGG - Intergenic
1029198937 7:98826090-98826112 GTCAAGAGAGATTTTATTTGGGG - Intergenic
1030716442 7:112813304-112813326 CTCAGGTTAGATGTCATTTGTGG - Intergenic
1033455739 7:141501874-141501896 AGCAGGTGAGATTTTATCTGGGG - Intergenic
1036943123 8:13070240-13070262 CCCAGGTGACATCTTAATTTTGG - Intergenic
1037668333 8:20992291-20992313 CACAGGTAACATTATATTAGTGG + Intergenic
1041007451 8:53509028-53509050 CTTGGGTGACTTTTGATTTGAGG - Intergenic
1043191602 8:77229558-77229580 CTCTGGTGACATTTTATGAAGGG - Intergenic
1043933300 8:86114922-86114944 CTCAGGCGTCAATATATTTGTGG + Intronic
1046235983 8:111424441-111424463 CTCAGATGACATTTTGATTGTGG + Intergenic
1046925025 8:119776963-119776985 CTCAGATCAAAATTTATTTGGGG + Intronic
1047343657 8:124006555-124006577 CCAAGGTGACATTTTAATGGGGG - Intronic
1047815724 8:128460270-128460292 CTGAGGTGGGATTTTATTTAGGG + Intergenic
1048665734 8:136658477-136658499 CTTAGGTGCCTTTTTATTTAGGG + Intergenic
1048937529 8:139369408-139369430 CACAGGTGACATTTTAATTATGG + Intergenic
1050171901 9:2828397-2828419 TCCATGTAACATTTTATTTGGGG + Intronic
1051788901 9:20777450-20777472 CACAAGAGACATGTTATTTGAGG - Intronic
1051937648 9:22463164-22463186 CTCAGGAGACATTTAATCAGTGG + Intergenic
1052452248 9:28646412-28646434 CTCAGCTAGCATGTTATTTGAGG - Intronic
1054812391 9:69445381-69445403 CTGAGCTGCCATTTTATTGGAGG + Intronic
1055733302 9:79301683-79301705 CTCAGATGAGATTCTCTTTGAGG + Intergenic
1058624195 9:106917323-106917345 TTCAGGTTACTTTTTATTTTAGG - Intronic
1059355393 9:113695669-113695691 CTCAGATGTCATTTAATTTCTGG + Intergenic
1186125793 X:6412390-6412412 TTCAGGCGTAATTTTATTTGGGG - Intergenic
1186769654 X:12805056-12805078 CATATGTAACATTTTATTTGGGG + Intronic
1188278265 X:28228896-28228918 TTCAAGTGACATTTTAATTATGG - Intergenic
1189703872 X:43740463-43740485 CTCAGTAGTCATTTAATTTGAGG - Intronic
1190997476 X:55624219-55624241 CTCTGGTAACATTTCATTTCAGG - Exonic
1193460282 X:81783113-81783135 TTCAGTTGACATTATATTTGAGG + Intergenic
1195661596 X:107384441-107384463 CTAAGGTCACATTCTTTTTGGGG - Intergenic
1195682861 X:107561853-107561875 CTCAGGTAACATTTTTTTCGAGG + Intronic
1196326856 X:114415679-114415701 CTCTAGTGACATTTTATTTCAGG - Intergenic
1197549307 X:127868699-127868721 ATCAGTTGACAATATATTTGAGG - Intergenic
1197985344 X:132260828-132260850 ATGAGGTAATATTTTATTTGTGG - Intergenic
1200779233 Y:7199380-7199402 CATAGATGACATTTTGTTTGTGG + Intergenic
1200897122 Y:8387594-8387616 CTATGGTGACATATTATTTGAGG - Intergenic