ID: 945268717

View in Genome Browser
Species Human (GRCh38)
Location 2:207917116-207917138
Sequence TTGAAGTAGAATGAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 1, 2: 6, 3: 58, 4: 571}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945268714_945268717 13 Left 945268714 2:207917080-207917102 CCACACTTTTAGAAGTCATCTAA 0: 1
1: 0
2: 0
3: 9
4: 175
Right 945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG 0: 1
1: 1
2: 6
3: 58
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945268717 Original CRISPR TTGAAGTAGAATGAGGAGAA TGG Intronic
901240389 1:7689669-7689691 TTCCAGAAGAATGAGGAGATTGG - Intronic
901310987 1:8269590-8269612 TTTAAATAGAGTGTGGAGAAGGG + Intergenic
901388539 1:8927257-8927279 TTGAAGTAGCCAGATGAGAATGG + Intergenic
902752201 1:18524561-18524583 TTGTAGTATGATGAGAAGAATGG - Intergenic
902957978 1:19939697-19939719 TGGAAGTGGGTTGAGGAGAAAGG + Intergenic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
904958491 1:34309990-34310012 TTGAAGAGGAGTGAGGAGAGTGG - Intergenic
905081327 1:35323646-35323668 AGGCAGGAGAATGAGGAGAATGG - Intronic
905133293 1:35777924-35777946 TGGAAATAGAATGGAGAGAAAGG - Intergenic
905535971 1:38722126-38722148 TTGAAGTCAAAAGAGAAGAAGGG + Intergenic
905837437 1:41139010-41139032 TTAAGGTAGGATGAGAAGAATGG + Intronic
906085656 1:43131409-43131431 TGAAAGAAGAAAGAGGAGAAAGG - Intergenic
906209034 1:44002148-44002170 TTGTTGGAGAATGAGGAGAGAGG - Intronic
907937608 1:59056857-59056879 TTCAGGTAGGATGGGGAGAAGGG + Intergenic
908693658 1:66811620-66811642 TTGAAGGAGAGTGAGGAGTGGGG + Intergenic
909470433 1:76021379-76021401 TTAAGGTAGAATGGGAAGAATGG - Intergenic
910033317 1:82759003-82759025 GGGAAGAAGAACGAGGAGAAGGG - Intergenic
910824680 1:91393242-91393264 TTGAGCAAGAATGAGAAGAATGG - Intronic
911461378 1:98195455-98195477 TTGAAGAGCAAAGAGGAGAAAGG + Intergenic
911521916 1:98939861-98939883 TTTAAGCAAAATGAGGTGAAAGG - Intronic
912746469 1:112249493-112249515 TGGAAGTGGAGTTAGGAGAAAGG - Intergenic
913315459 1:117547337-117547359 TTAAAGCAGAATGATGAGAATGG + Intergenic
913466644 1:119149780-119149802 TTGAATTGGAAAGAGGAGCAGGG + Intergenic
914960093 1:152197426-152197448 AAGAAGGAGAAGGAGGAGAAGGG - Intergenic
915301905 1:154956518-154956540 TTGGAGCAGATTGGGGAGAATGG - Intergenic
915687580 1:157650152-157650174 TGGAATGAGAATGAGGGGAAAGG - Intergenic
916517836 1:165536512-165536534 ATGGAGTTGATTGAGGAGAAAGG - Intergenic
917078038 1:171226437-171226459 TAGTAGTAAAATCAGGAGAAAGG + Intergenic
917392784 1:174557459-174557481 TAGAAGTAGAATGACGGGGATGG - Intronic
918565214 1:185921646-185921668 TTTAAGTAGAAGTAGGAGATGGG - Intronic
918754298 1:188317687-188317709 TTGAAATAGAAAGAAAAGAATGG + Intergenic
919045049 1:192440858-192440880 TTTAAGTAGAATGATCAGGATGG + Intergenic
919185800 1:194147461-194147483 TTTAGGCAGAATGAGAAGAAAGG - Intergenic
920166921 1:204042592-204042614 TGGAAGTTGAAAGAGGACAAAGG + Intergenic
920339908 1:205269283-205269305 CTGAAGGAGATTGAGCAGAACGG + Exonic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
921278517 1:213542968-213542990 GTAAAGGAGAATGAGGAGCAGGG + Intergenic
921303011 1:213768386-213768408 AAAAAATAGAATGAGGAGAAAGG + Intergenic
921335931 1:214086253-214086275 TTGAGGTAAAATAAGGAAAAAGG - Intergenic
923207853 1:231776037-231776059 TTGGCGTAAATTGAGGAGAATGG + Intronic
924902434 1:248415642-248415664 GTGAAGTAGACTAAGGAGAAAGG + Intergenic
924906630 1:248460634-248460656 TTAAAGTAGAAATAGGAGACTGG - Intergenic
1062881126 10:979241-979263 TTGAAATAGATTGAGAAGACCGG - Intergenic
1063796414 10:9518021-9518043 TGGAAGGATACTGAGGAGAAAGG - Intergenic
1065165887 10:22976511-22976533 TTGAAGAACAATCAGGAGAGAGG - Intronic
1065672311 10:28133370-28133392 TTCAAGTTGAATGAGGAGGAGGG - Intronic
1065977627 10:30857115-30857137 TTGAAGGAAAATGAAGAAAAAGG - Intronic
1066018342 10:31270890-31270912 TTGATGTTGGATGATGAGAAAGG + Intergenic
1066263337 10:33750481-33750503 TTGAAGCATGATGAGGAAAAGGG + Intergenic
1066318617 10:34276572-34276594 TTGCAGTAGAATAAGATGAAAGG + Intronic
1067331198 10:45321135-45321157 TTGAAGAGGAATGGGGAGAGAGG + Intergenic
1068033189 10:51728717-51728739 ATGGAATAGAATGATGAGAAAGG + Intronic
1068037956 10:51784322-51784344 TTGAAATACCATGAGGAAAAAGG - Intronic
1068507123 10:57915173-57915195 ATTAAGTAGACTGAGGAGGAGGG + Intergenic
1068509526 10:57946670-57946692 TGGAAGGTGAAAGAGGAGAAAGG - Intergenic
1068972269 10:62972375-62972397 TTCAAGTATACTGAGGAGAAGGG + Intergenic
1070270383 10:74948471-74948493 GGAAAGTAGAATGAGGAGATGGG - Intronic
1071154021 10:82669013-82669035 ATAAAGAAGAACGAGGAGAAGGG - Intronic
1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG + Intronic
1072141613 10:92593400-92593422 GCGAAGAAGAAAGAGGAGAAGGG + Exonic
1072747866 10:97954195-97954217 TTGAAGTAAAATGAGGGAAGAGG + Intronic
1072815240 10:98501653-98501675 TTGAAGAGGAGTGAGGAGAGTGG - Intronic
1073085739 10:100887493-100887515 TTGAGGAAGAATGAGGAGCAAGG - Intergenic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1075473190 10:122709509-122709531 TTAAAGAAAAGTGAGGAGAAGGG + Intergenic
1076089563 10:127670475-127670497 CTGAAGTTGATTAAGGAGAAAGG + Intergenic
1076350708 10:129813170-129813192 TTTTAGGAGAATGAAGAGAATGG + Intergenic
1076387959 10:130072255-130072277 TTGAAGTAGAATAACAAGCAAGG - Intergenic
1076807444 10:132866146-132866168 TTGAAGATGAATGGGGAGACCGG - Exonic
1078801355 11:14646883-14646905 TAGAAGTAGAATGTGAATAAGGG - Intronic
1080152341 11:29067748-29067770 TTGAATTAGAGTGATGAGACTGG - Intergenic
1080152697 11:29072565-29072587 TTGAAGAGGAGTGATGAGAAGGG + Intergenic
1080212816 11:29806690-29806712 TTGAGGCAGGAAGAGGAGAATGG + Intergenic
1080263510 11:30376208-30376230 TAGAGGAAGAAAGAGGAGAAAGG + Intergenic
1081102995 11:39028550-39028572 CTGAAATAGAATGAGGTGTATGG + Intergenic
1081360462 11:42171218-42171240 TTGAAGTTGAGTGATGACAAAGG + Intergenic
1082014979 11:47478617-47478639 TTGAAGAAGAATATGGAAAAGGG - Intronic
1082295576 11:50437968-50437990 TTGGAGTACATTGAGGACAAAGG + Intergenic
1082851739 11:57771364-57771386 GTAAAGTAGAATGAGTAGTATGG + Intronic
1082947055 11:58771758-58771780 ATGAAGTCGAAGGGGGAGAATGG + Intergenic
1083076326 11:60042740-60042762 TGGAAAGAGAAAGAGGAGAAAGG - Intronic
1083126667 11:60575161-60575183 TTAAAGAAGAATGAAGTGAAAGG + Intergenic
1083378606 11:62245816-62245838 TTGATGTAGAAAGAAAAGAAGGG - Intergenic
1085342245 11:75740273-75740295 TTGATGTATTATGATGAGAATGG + Intergenic
1085748252 11:79133950-79133972 TTGAAGAAGAGTGATGAGAGTGG - Intronic
1086082462 11:82919133-82919155 TTGAAGAAGAATGGTGAGAGTGG + Intronic
1086260483 11:84933899-84933921 TTGAACAAGAGTGATGAGAAAGG + Intronic
1086821277 11:91438977-91438999 TTGAAGGAAAACAAGGAGAATGG - Intergenic
1087137051 11:94731493-94731515 TTGAAGTAGGATGAGGATACTGG + Intronic
1087221871 11:95555016-95555038 TAGAAGTAGAATTAGAGGAAGGG + Intergenic
1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG + Intronic
1087863730 11:103197263-103197285 CTGAAATAGAAGGAGGAAAATGG + Intronic
1087879474 11:103398562-103398584 AACTAGTAGAATGAGGAGAAGGG + Intronic
1087900770 11:103637900-103637922 TTAAAGTTGAATGTGAAGAAAGG - Intergenic
1087930682 11:103974105-103974127 TAGAAGAAGAAAGAGGAAAAAGG + Intronic
1089482572 11:118818991-118819013 TTGGGGTAGACTCAGGAGAAAGG - Intergenic
1089980667 11:122769481-122769503 TAGAAGAAAAATGAGGATAAGGG - Intronic
1090363756 11:126190030-126190052 TTGATGCAGAAAGAGGGGAAGGG - Intergenic
1090830963 11:130420564-130420586 TGGGAGTGGAAGGAGGAGAAAGG + Intronic
1092456693 12:8650198-8650220 TAGAAGGAGACTGAAGAGAATGG - Intronic
1092649307 12:10615552-10615574 TTCAAGTAGAATGACTAAAAAGG + Intergenic
1092798177 12:12135194-12135216 TTGAAGTAGAACCAGGTGCATGG + Exonic
1093482570 12:19619787-19619809 TTGAAGGAGAATAGAGAGAAAGG - Intronic
1094386367 12:29898234-29898256 TGAAAGTAGAAAGAAGAGAAAGG + Intergenic
1095201834 12:39393735-39393757 TTGCAGTGGAGTGAGGAGAAAGG + Intronic
1095381062 12:41592663-41592685 TTGAAGTAGAAGTAGGAGTAGGG + Intergenic
1095556879 12:43517732-43517754 TTGAAGAAGAATGAAGTCAAAGG + Intronic
1096729113 12:53592499-53592521 TTGAGGTAGAATGTGTAGAATGG - Intronic
1096753812 12:53782091-53782113 ATAAAGCAGAATGAGGAGAAAGG + Intergenic
1097055699 12:56247926-56247948 GTGGAGTAGGGTGAGGAGAATGG - Intronic
1097971324 12:65636233-65636255 ATGTAGGAGAATGAGGAGAGAGG + Intergenic
1098175518 12:67786252-67786274 TTGAAGTTGAATGTGCAGACTGG - Intergenic
1098228068 12:68345310-68345332 ATGAAGGAGAAAGAGCAGAATGG - Intergenic
1098560858 12:71870246-71870268 AGGAAGGAGAAGGAGGAGAAGGG - Intronic
1099837334 12:87923452-87923474 GTGAAGTAGAAGCAGGAAAATGG + Intergenic
1100100525 12:91098591-91098613 TAGAAGCAGAAAGAGTAGAATGG + Intergenic
1100556485 12:95699520-95699542 TTTGAGTAGAATGTGAAGAATGG + Intronic
1100580211 12:95931826-95931848 TTTAAGTAGAGTGATCAGAATGG + Intronic
1100851721 12:98719020-98719042 ATGGAGTAGAACGAGGATAAGGG - Intronic
1101220596 12:102635203-102635225 CTGGAGTACAATGAGGAGAGAGG + Intergenic
1102406282 12:112676896-112676918 TTGAGGAAGAATGAGGGGCAAGG + Intronic
1103228783 12:119310224-119310246 TGGAATTGAAATGAGGAGAAAGG - Intergenic
1103670552 12:122611373-122611395 TTGGAGCAGAGAGAGGAGAAGGG + Intronic
1104623010 12:130332384-130332406 TTGATGAATAATGAGCAGAACGG - Intergenic
1105550818 13:21394197-21394219 CTGGGGTAGAATGAGCAGAAAGG - Intronic
1105880794 13:24605146-24605168 TTGAAGGAAAAAGAAGAGAAGGG - Intergenic
1106035761 13:26043614-26043636 AGGCAGGAGAATGAGGAGAATGG + Intergenic
1106374006 13:29166137-29166159 TCTAAGTAGAATGAGGACACAGG + Intronic
1106617382 13:31341818-31341840 TTGAAAAAGAATTAGAAGAATGG + Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1107237958 13:38196085-38196107 TGGAAGTAGAGTGATCAGAAAGG + Intergenic
1108812141 13:54240315-54240337 TTAAAGCAGAATAAGGAGGATGG - Intergenic
1110004420 13:70248489-70248511 TAGAGGAAGAATGAGGAGAGTGG - Intergenic
1110399293 13:75071045-75071067 AGGAAGCAGAATGAAGAGAAAGG - Intergenic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1110541940 13:76715920-76715942 TTGAAGCAATATGTGGAGAAGGG + Intergenic
1110662275 13:78070859-78070881 TTGATTTTGAATGAGGTGAAAGG + Intergenic
1111326035 13:86697034-86697056 TTGAAGGAGAGTGAGAAAAATGG - Intergenic
1111477489 13:88771515-88771537 TTGAAGTAGAAGGAAGAGAAGGG - Intergenic
1111584602 13:90268395-90268417 TTGCAGTGGAATGACGGGAATGG - Intergenic
1111847846 13:93534081-93534103 CTGAAGGAGTATGAGGAGATGGG + Intronic
1112509834 13:99998993-99999015 TTGAAGGAGAAAGACCAGAAAGG - Intergenic
1112572075 13:100602072-100602094 TTGAAATAAAATGTGAAGAATGG + Intergenic
1112945657 13:104923757-104923779 TTGAAGAGGAGTGATGAGAATGG - Intergenic
1113279413 13:108772524-108772546 TTGAAGGAGACTAAAGAGAAAGG + Intronic
1113898837 13:113784545-113784567 AAGAAGAAGAAGGAGGAGAAGGG + Intronic
1113954618 13:114090863-114090885 TTCAAGTAGAAGGTGGAGAGAGG + Intronic
1113991878 14:16034433-16034455 GGGAAGTAGAATAAGGAGAAGGG - Intergenic
1114449605 14:22816400-22816422 AGGCAGGAGAATGAGGAGAATGG + Intronic
1114713446 14:24801657-24801679 TGGAAGCAGCAGGAGGAGAAGGG + Intergenic
1114856763 14:26456243-26456265 TTGAAGTAGATGGTGGAAAAGGG + Intronic
1116476735 14:45348866-45348888 TTGTAAGAGAATGTGGAGAATGG - Intergenic
1117057840 14:51931171-51931193 TAGCAGTAGAACGAGGATAAGGG + Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1118019678 14:61697172-61697194 TTGAAGAAGGACCAGGAGAAGGG - Intronic
1118411129 14:65479565-65479587 TGGAAGTAGGAGAAGGAGAAAGG - Intronic
1118840400 14:69505685-69505707 ATGAAGTAGAACGCGGGGAAGGG + Intronic
1119016672 14:71064391-71064413 TAGCAGCAGAATAAGGAGAATGG - Intronic
1119651283 14:76385451-76385473 TTTAAGAAGGATTAGGAGAAAGG + Intronic
1119757754 14:77130806-77130828 TGGAAGGAGAAGGAGGAAAAGGG + Intronic
1120410929 14:84154354-84154376 TGGAAGGTGAAAGAGGAGAATGG - Intergenic
1120511574 14:85421878-85421900 AAGAAGTAGAATGGGGAGGAGGG - Intergenic
1122304524 14:100753646-100753668 TTAAAGTTAAATGGGGAGAAAGG + Intergenic
1122699502 14:103578262-103578284 TTGCAGAAGAATGGGAAGAATGG + Intronic
1123986762 15:25653153-25653175 ATGGAGAAGAACGAGGAGAACGG - Intergenic
1125286711 15:38101083-38101105 TTATAGTAGAATGATTAGAATGG - Intergenic
1125310061 15:38369655-38369677 CTGAAGTCAAGTGAGGAGAACGG - Intergenic
1125433067 15:39616862-39616884 TTGAAGTTGTAGGAAGAGAAAGG + Intronic
1125679820 15:41523615-41523637 TGGAGGTAGAAAGAGGAGGAAGG + Intronic
1125901306 15:43350416-43350438 TAGAAGCAGAAGGAGGTGAATGG + Intronic
1126355935 15:47795969-47795991 TTGAAGTAAAAGGGGGAAAATGG - Intergenic
1126482759 15:49144272-49144294 TTGAAGGTGAAAAAGGAGAATGG - Exonic
1127226916 15:56940737-56940759 GAGAAGGAGAAGGAGGAGAAGGG - Intronic
1128124946 15:65185362-65185384 TAGAAGGAGAAGGAGGGGAAGGG - Intergenic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128935859 15:71745977-71745999 TTGAAGAAGAACAAGGGGAAAGG + Intronic
1129011357 15:72420771-72420793 CTGAAGCAGAATGAGGAAGAGGG - Intergenic
1130043086 15:80421390-80421412 TTGAAATAGAAAGAAAAGAAAGG + Intronic
1130246368 15:82253383-82253405 GTGAAGTTGATTGAGGGGAAGGG + Intronic
1130333795 15:82941751-82941773 TAGAAGGTGAATGTGGAGAAAGG - Intronic
1131325130 15:91435959-91435981 CTGAAGTAGCATAAGGAGCATGG - Intergenic
1131429532 15:92375682-92375704 TTGAGGGAGAATGAGCATAAAGG + Intergenic
1131701663 15:94943097-94943119 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131701670 15:94943134-94943156 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131933864 15:97479369-97479391 TTGAATAAGAATGGTGAGAATGG + Intergenic
1132693704 16:1192897-1192919 TTGAAGGAGAGTGTGGAGAGAGG + Intronic
1133885736 16:9825962-9825984 TGGAAGGAGTAGGAGGAGAAGGG + Intronic
1134204639 16:12227187-12227209 GGGAAGTAAAATGGGGAGAAAGG - Intronic
1135656128 16:24251717-24251739 TGGAGGTAGAAGGAGGGGAATGG - Intergenic
1136129954 16:28213391-28213413 TTGAATAGGAATGATGAGAAAGG + Intergenic
1136911197 16:34146007-34146029 GGGAAGTAGAATAAGGAGAAGGG - Intergenic
1137896063 16:52214090-52214112 TGGAAGGGGAAGGAGGAGAAGGG - Intergenic
1138659109 16:58507438-58507460 TTGTAGAAGAATGAGAAGGAGGG - Intronic
1138897770 16:61229321-61229343 TTGATGTAGAATGAATAAAATGG + Intergenic
1140320156 16:73942953-73942975 TGGAAGTAGAGTGGGGAGGAAGG - Intergenic
1140973571 16:80037529-80037551 TTGATCAAGAATTAGGAGAAGGG + Intergenic
1141061801 16:80880152-80880174 TTTAAATAAAATGAAGAGAATGG - Intergenic
1142529640 17:571211-571233 CTGAAGTAGGAGGAGGGGAAGGG + Intronic
1143066549 17:4253556-4253578 GAGAAGTAGAAGGATGAGAAGGG - Intronic
1143079363 17:4369922-4369944 CTGGAGTAGAATGAAGAGAAGGG - Intergenic
1143080168 17:4375764-4375786 CTGGAGTAGAAGGAAGAGAAGGG + Intergenic
1143080420 17:4377313-4377335 CTGGAGTAGAAGGAAGAGAAGGG - Intergenic
1143615183 17:8045413-8045435 GTGAAGAAGAGTCAGGAGAATGG + Intronic
1143954502 17:10657872-10657894 GAGGAGTAGAAGGAGGAGAAGGG - Intergenic
1146223495 17:31047001-31047023 TTAAAGGAGAATGAGGAGAAGGG + Intergenic
1146341491 17:32022967-32022989 TTAAAGGAGAATGAGGAGAAGGG - Intronic
1146620732 17:34395160-34395182 TTGATGGAGGGTGAGGAGAATGG + Intergenic
1147038108 17:37696882-37696904 GTGAAGTAAAATGAGGGTAAAGG - Intronic
1147875093 17:43615356-43615378 TTGAATTAAAATGAGAAAAATGG - Intergenic
1148070714 17:44907055-44907077 TTGCGTTAGAATGAGGAGGAAGG - Intronic
1148173846 17:45547563-45547585 TTAAAAGAGAATGAGGAGAAGGG + Intergenic
1148275422 17:46297884-46297906 TTAAAAGAGAATGAGGAGAAGGG - Intronic
1148297527 17:46515463-46515485 TTAAAAGAGAATGAGGAGAAGGG - Intronic
1148362079 17:47019942-47019964 TTAAAGGAGAATGAGGAGAAGGG - Intronic
1149329092 17:55563066-55563088 TTGAAGTAGGCTGTGGAAAAGGG + Intergenic
1149688904 17:58556930-58556952 CTGAAGCAGAAAGAGAAGAAAGG + Exonic
1150136184 17:62696593-62696615 TTGAAATGAAATGAGCAGAAAGG - Intergenic
1150405059 17:64894485-64894507 TTAAAAGAGAATGAGGAGAAGGG + Intronic
1150749889 17:67850998-67851020 TTGTAATGGAAAGAGGAGAAGGG + Intronic
1150880425 17:69019475-69019497 TTGAAGAAGAGAGAGGAGAATGG - Intronic
1150928236 17:69556677-69556699 TTAAAGTAGAAAATGGAGAAAGG + Intergenic
1151418193 17:73980452-73980474 GGGAAGGATAATGAGGAGAAAGG + Intergenic
1153974964 18:10261266-10261288 TTGAAGAAGAAAGAGGTGAATGG - Intergenic
1154016230 18:10620386-10620408 CTGAGGTAGAATGAGGTAAATGG - Intergenic
1154189284 18:12215265-12215287 CTGAGGTAGAATGAGGTAAATGG + Intergenic
1155766606 18:29642387-29642409 CTGAAGTACAGTGAGGAAAAAGG - Intergenic
1155785361 18:29891800-29891822 TTCCAGTAGAAGGAGGAGAGAGG + Intergenic
1156515883 18:37679859-37679881 TTAATGCAGAATGAGGACAAGGG + Intergenic
1156591680 18:38496870-38496892 TTGAGGAATAATTAGGAGAAAGG + Intergenic
1156650524 18:39221062-39221084 TTGAAAAAGAATAATGAGAATGG - Intergenic
1156824682 18:41416552-41416574 TTGAAATAGAGTGTGGAGCAAGG + Intergenic
1156867110 18:41901193-41901215 TTGAACCAGACTGAGGAGTAAGG + Intergenic
1157584035 18:48790104-48790126 TGGAAGTAGAATGAGGACAGAGG + Intronic
1157972623 18:52287642-52287664 TTGATGTAGACTCAGGAGCAGGG - Intergenic
1158786000 18:60712467-60712489 AGGAACTAGAATTAGGAGAAGGG + Intergenic
1159702490 18:71646423-71646445 TGGAAGCAGCATGAGGAGAAAGG - Intergenic
1159878792 18:73838420-73838442 CTGATGGAGAATGAGGACAAGGG + Intergenic
1160170015 18:76545005-76545027 TTTAAGAAGAATAAGTAGAAAGG - Intergenic
1161048552 19:2150374-2150396 TTGAAGAAGAATGGGCAGAGTGG - Intronic
1161695687 19:5766489-5766511 TTGGAGTGGAGTGAGGAGAGGGG + Intronic
1163896805 19:20066503-20066525 TTGCAATGGAAAGAGGAGAAGGG - Intergenic
1164082232 19:21868536-21868558 AAGAAGTAGAATGAGGAAAAAGG - Intergenic
1164188698 19:22896061-22896083 GGGAAGTAGAATAAGGAAAAAGG - Intergenic
1164189821 19:22903858-22903880 GAGAAGTAGAATAAGGAAAAAGG - Intergenic
1164298877 19:23941017-23941039 TTGAAGTGGAGTGTTGAGAATGG + Intronic
1165404425 19:35621040-35621062 TTGATGGGGAGTGAGGAGAAAGG + Intronic
1165678795 19:37754680-37754702 CTAAAATAGAATGATGAGAAAGG + Intronic
1165768543 19:38365218-38365240 TTGAGAAAGAATGAGAAGAAAGG - Intronic
1165956430 19:39504445-39504467 TTGAAGTAGGATTAGGTGATGGG + Intronic
1166024835 19:40072666-40072688 AAAAAGAAGAATGAGGAGAAAGG + Intronic
1167208435 19:48118007-48118029 TTGAAGTAAAAAGTTGAGAAAGG + Intronic
1167307858 19:48719432-48719454 TTGAAGGAGAAGGAGGTTAAGGG + Intronic
1167580122 19:50336509-50336531 TTGAAGTAAAAGGAGAAGACAGG + Intronic
925032535 2:661798-661820 GTGAAGTAACATGATGAGAATGG - Intergenic
925680599 2:6417033-6417055 TTGCAATAGAAAGGGGAGAAGGG + Intergenic
925951121 2:8912194-8912216 TTGAAGAGGAGTGTGGAGAATGG - Intronic
926255484 2:11191370-11191392 TTGAGGTAGAGTTAGGAAAATGG - Intronic
927679227 2:25129209-25129231 GTGAAATGGAATGGGGAGAAAGG + Intronic
928870055 2:35965217-35965239 CTGAATTAAAAAGAGGAGAAAGG + Intergenic
929317339 2:40495685-40495707 TTCCTGTAGAATGAGGAGACTGG - Intronic
929541111 2:42822962-42822984 TTCAGGTAGAATCAGGTGAATGG - Intergenic
929899971 2:45992445-45992467 TTCACGCAGAATGAGGAGAAAGG - Intronic
930486178 2:52014161-52014183 TTGAAGAGGAATGGTGAGAATGG + Intergenic
931238015 2:60428210-60428232 TAGAAGGAGAATGAGGTAAAAGG + Intergenic
931590532 2:63878245-63878267 TTGAAGCAGAATTATGAGAGTGG + Intronic
931749025 2:65314681-65314703 TTGAAATAGAATAAGGACACTGG + Intronic
931773056 2:65516087-65516109 TGGAAGTAGACTGTGGAGCAAGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932988905 2:76762468-76762490 TTGAAGTAGTTTGGGGTGAAGGG - Intronic
933091694 2:78127505-78127527 TAGAATTACAATCAGGAGAAAGG + Intergenic
935026428 2:99281625-99281647 AAGAAAGAGAATGAGGAGAAGGG + Intronic
935557320 2:104524281-104524303 TTTAAGTAGAATGTCAAGAAGGG - Intergenic
935814119 2:106830458-106830480 CTTAAGTAAAATGAGGAAAAGGG + Intronic
936109848 2:109656014-109656036 TTGAACTAGACTTAGAAGAATGG - Intergenic
936941132 2:117885560-117885582 TTAAAATAGAATCAGAAGAAGGG - Intergenic
937109948 2:119357686-119357708 TTGAATAAGAATGGTGAGAATGG - Intronic
937229312 2:120388316-120388338 TTGAAGGATAATGAGGAGGAAGG + Intergenic
937343872 2:121110621-121110643 TGGAAGGAGACTGAGGAGACAGG + Intergenic
937493887 2:122398112-122398134 ATGGTGTAGAATGAGGAAAATGG + Intergenic
937791460 2:125967052-125967074 TTGGAGCAGAAGGAGGAGATTGG - Intergenic
938079910 2:128364483-128364505 TGGAAGGAGCAAGAGGAGAAGGG - Intergenic
939271237 2:139942888-139942910 TGGAAGGTGAATGAGGAGCAAGG - Intergenic
939291309 2:140198894-140198916 TAAAAGGAGGATGAGGAGAAGGG + Intergenic
939585766 2:144003656-144003678 TTGAGAAAGAATGAGGAGAGGGG + Intronic
940007148 2:149018390-149018412 GGGATGTAGAATGAGGAGACAGG - Intronic
940229084 2:151430939-151430961 TTGTAGTAGAATGAGCACAGTGG - Intronic
940336978 2:152539437-152539459 TGGAGGTAGAAAGAGGAGATGGG + Intronic
940466061 2:154028461-154028483 TTTAAGTAGAAAGAAGAGGATGG - Intronic
940805002 2:158177211-158177233 TTTCAGTAGAAGGAGGACAATGG - Intronic
941132653 2:161672805-161672827 TTCAAGTATAATGATGTGAATGG + Intronic
941332903 2:164201800-164201822 GAGAAGTAGAATGAAGAGAGAGG - Intergenic
941513184 2:166438727-166438749 TGGCAGTAGAATAAGTAGAAGGG - Intronic
941774079 2:169372879-169372901 TTGATTTAATATGAGGAGAATGG - Intergenic
941776259 2:169396673-169396695 TGGAAGGAGGAGGAGGAGAAGGG + Intergenic
941854535 2:170217504-170217526 TTAAAGTTCAATGAGGATAATGG - Intronic
942394365 2:175531391-175531413 TTGAAGAACACTAAGGAGAAAGG - Intergenic
942861379 2:180616955-180616977 TGGAAGTAGAGTGAGGTGAGGGG + Intergenic
943657144 2:190521789-190521811 GAGAAGTATAATAAGGAGAAGGG - Intronic
944494614 2:200294438-200294460 GTGAAGGAGAAAGAGGATAATGG - Intergenic
944925454 2:204459272-204459294 TTGAAATAGAAGTAGAAGAAAGG + Intergenic
945180818 2:207089134-207089156 TGGATGGACAATGAGGAGAAAGG + Intronic
945260557 2:207839419-207839441 TTGATGTAAATTTAGGAGAAAGG + Intronic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
945428267 2:209734731-209734753 TTGGAGTAGAAGGAGAATAAGGG + Intergenic
945563858 2:211371512-211371534 GGGAAGGAGAATGAGGATAAAGG + Intergenic
945575071 2:211520498-211520520 ATGAAGAAGAAAGAAGAGAAGGG + Intronic
945623802 2:212174568-212174590 ATCAAGTAGAATGAGTAGCATGG - Intronic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946833011 2:223744390-223744412 ATAAATTAGAATGAGGAAAAGGG + Intergenic
947438109 2:230090841-230090863 TGGAGGGAGAATGAAGAGAAAGG - Intergenic
1168765601 20:380199-380221 TCTCAGTAGAATGTGGAGAATGG + Intronic
1169655238 20:7915335-7915357 GTGAAGGAGAATAAGAAGAAGGG + Intronic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1170045019 20:12075757-12075779 TTGAAGAAGACAGATGAGAAGGG - Intergenic
1170726372 20:18931040-18931062 TTGAACTAGAAAGAGAAGGATGG + Intergenic
1170876055 20:20251270-20251292 CTGAAGTAGAAGCAGAAGAAAGG + Intronic
1171013311 20:21520304-21520326 TTGAAAAAGAATAGGGAGAAGGG - Intergenic
1171769983 20:29314834-29314856 GGGAAGTAGAATAAGGAGAGGGG + Intergenic
1171812697 20:29758016-29758038 GAGAAGTAGAATAAGGAGAAGGG + Intergenic
1171906546 20:30904270-30904292 GGGAAGTAGAATAAGGAGAAGGG - Intergenic
1171948823 20:31402737-31402759 TGGTAGAAGATTGAGGAGAAAGG + Intergenic
1172017604 20:31887309-31887331 TTGAAGTAGAAAAGGGAGAGAGG - Intronic
1172068674 20:32239990-32240012 ATAAAGAAGAAAGAGGAGAAAGG + Intergenic
1172822004 20:37744730-37744752 TTGTAGTAGAATAATGATAAGGG + Intronic
1173070271 20:39757706-39757728 CAGAAGTAGAGTGAGGAGTAAGG + Intergenic
1173375446 20:42478391-42478413 CTGATGTAGAAAGAGGAGCAGGG - Intronic
1173912598 20:46681396-46681418 TGGAAGTAGAGGAAGGAGAAGGG + Intronic
1174918347 20:54676574-54676596 TTCAAGTCTAATGAGGACAATGG - Intergenic
1175055245 20:56191978-56192000 TTGAAGAAGAGAGAAGAGAAAGG - Intergenic
1175733134 20:61367640-61367662 CTGAAGTAAATAGAGGAGAAAGG + Intronic
1176814955 21:13590744-13590766 TTGAATAAGAATGGTGAGAAAGG - Intergenic
1176949601 21:15029469-15029491 TTGAAGCAAAGAGAGGAGAATGG - Intronic
1177656535 21:24023585-24023607 TTTAATTATATTGAGGAGAAGGG + Intergenic
1177689586 21:24488118-24488140 TGGAAGAAGAAAGAGGAGAGTGG + Intergenic
1177945679 21:27467134-27467156 TGGACGTAAATTGAGGAGAAAGG - Intergenic
1178210192 21:30521621-30521643 TTGAATTAGAATGATAAGAAAGG + Intergenic
1178500666 21:33123442-33123464 TTGCCAGAGAATGAGGAGAACGG + Intergenic
1179359928 21:40696287-40696309 TTGGGGTCGAATAAGGAGAAGGG - Intronic
1179606222 21:42517242-42517264 TTGAAGGAGAGGGAGCAGAAAGG + Intronic
1180315394 22:11273093-11273115 GGGAAGTAGAATAAGGAGAAGGG + Intergenic
1180339957 22:11610389-11610411 GGGAAGTAGAATAAGGAGAAGGG - Intergenic
1181883405 22:25999595-25999617 GAGAAGGAGAAGGAGGAGAAAGG - Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182659665 22:31916351-31916373 TTGAGGTCGAGTGAGGTGAATGG - Intergenic
1183175846 22:36224172-36224194 CTGAACTAGGAAGAGGAGAATGG + Intergenic
1183594728 22:38803859-38803881 GTGAAGCAGAAAGAAGAGAAAGG - Intergenic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1203307913 22_KI270736v1_random:122407-122429 TTGGAGTGGAATGAGGGGAGTGG + Intergenic
1203312756 22_KI270736v1_random:154265-154287 TTGAAGTAGAGTGAAGTGGAAGG + Intergenic
949233830 3:1784526-1784548 TTGATGTTGAATGGGAAGAAGGG + Intergenic
949494856 3:4621846-4621868 TTGGAGTTGCAGGAGGAGAAAGG - Intronic
950232891 3:11292135-11292157 ATGAAGTTGCATGAGGAGCATGG + Intronic
950632279 3:14290394-14290416 TTGAAGTAGAGTGAGGTGGTTGG - Intergenic
951109013 3:18779139-18779161 TAGAAATAGATTCAGGAGAATGG - Intergenic
951685563 3:25340145-25340167 TTCAAGAAGAATGAGGAGTTTGG + Intronic
952044260 3:29299051-29299073 TTGACTTAAATTGAGGAGAAAGG + Intronic
952127425 3:30317567-30317589 CTTAAGTAGAACGAGGAAAATGG + Intergenic
952183364 3:30942501-30942523 TAGAGGCAGAATGAGGAAAATGG - Intergenic
952735445 3:36686731-36686753 TTGAAACAGAATGATGAGAGGGG - Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954010674 3:47634550-47634572 CTGAAGTAGAATGAAGAACAGGG + Intronic
955545626 3:60026159-60026181 TTGAAGAAGAAAGAGTAGACAGG - Intronic
955635032 3:61018863-61018885 TTAAAGTAGAATGAGGATCTAGG - Intronic
955958424 3:64314051-64314073 TAGAAGTAGAATAAGGTGAGGGG - Intronic
956057717 3:65318219-65318241 TTGTTGTAGAGAGAGGAGAAGGG - Intergenic
956117020 3:65929253-65929275 TTGAGTTAGATTGAGGAGAAAGG - Intronic
957086539 3:75684621-75684643 TTGATGGAGAACCAGGAGAAAGG - Intergenic
958552886 3:95639114-95639136 TTCAAGTAGAAAGAGAAAAAAGG + Intergenic
958910288 3:99986679-99986701 CTCAAGTAGAAGGAGGAGAATGG + Intronic
958962535 3:100523679-100523701 GAGAAGGAGAAGGAGGAGAAAGG - Intronic
959499908 3:107094316-107094338 TTGAAAAGGAATGATGAGAAGGG - Intergenic
959722382 3:109507273-109507295 TTAAAGTAAAATGAGAAAAAGGG + Intergenic
960044882 3:113187035-113187057 TTGGGGAAGAATGAGGGGAATGG - Intergenic
960261983 3:115578624-115578646 TTGAAGTTGAAGGTGGAAAAAGG + Intergenic
960326962 3:116308999-116309021 TTGCTGTAGAATGAGGCAAAGGG - Intronic
960722795 3:120641244-120641266 CGGTGGTAGAATGAGGAGAAAGG - Intronic
960732674 3:120743681-120743703 TTGAAGGATGATTAGGAGAAGGG + Intronic
962280624 3:134049144-134049166 GGAAAGGAGAATGAGGAGAATGG - Intronic
962428541 3:135297780-135297802 CTGAAGGAGAAGGAGAAGAAAGG + Intergenic
962856290 3:139348359-139348381 TTGAAATACTATGTGGAGAAGGG + Intronic
963621498 3:147612982-147613004 TTTCAATAGAATGAGGACAATGG + Intergenic
963932970 3:151023453-151023475 AGGAAGGAGAAAGAGGAGAAAGG + Intergenic
964086975 3:152830778-152830800 CTGAAGTTGAGTGAGGAAAAAGG - Intergenic
964400978 3:156298049-156298071 TTAAAGTAAAATGGTGAGAATGG + Intronic
964426142 3:156555528-156555550 TTGAAGAAGAAAGAAGAGAAAGG + Intergenic
965117130 3:164504592-164504614 TTGAATGGGAATGATGAGAATGG + Intergenic
965219325 3:165906123-165906145 TTGAAGTAGTATAAAGTGAATGG + Intergenic
965494350 3:169379353-169379375 TTGAAGGAGAAAGAGGAGAAAGG + Intronic
965501975 3:169468005-169468027 TTGACATAAAAAGAGGAGAAGGG - Intronic
965622262 3:170653778-170653800 AAGAAGAAGAAGGAGGAGAAGGG - Intronic
965753031 3:171997382-171997404 TTAAAGCAGACTGAGGAAAAAGG + Intergenic
965962521 3:174445151-174445173 TTTTAGTAGAGTGAGGAGAAGGG + Intronic
966066375 3:175826798-175826820 TTGGAGCAGAAGGATGAGAAAGG - Intergenic
966213820 3:177480577-177480599 TGGCAGGAGAAAGAGGAGAATGG - Intergenic
967187533 3:186957999-186958021 TTCAGGTTGAAGGAGGAGAATGG + Intronic
967282876 3:187839240-187839262 TAGTAGTAGAAAGAGGGGAAGGG + Intergenic
967289394 3:187904337-187904359 TTGAAGAAGGCTGAAGAGAAAGG - Intergenic
967473114 3:189886066-189886088 TTGAAGGGAAAAGAGGAGAAGGG + Intronic
967715124 3:192753833-192753855 TGGCGGTAGAGTGAGGAGAAGGG - Intronic
967743038 3:193023787-193023809 TTAAAGTATAATGAAGTGAAAGG - Intergenic
967962099 3:194933658-194933680 CTGAAGTTGAATCAGGACAACGG + Intergenic
968780297 4:2575351-2575373 TTGAAGGAGGATCAGGAGCATGG + Intronic
969657690 4:8507567-8507589 AAGAAGGAGAAAGAGGAGAAAGG - Intergenic
970224302 4:13841402-13841424 CTTTAGTAGAATGAGGAGCATGG - Intergenic
970663155 4:18308485-18308507 CTGAAATGGAATGAGGATAATGG + Intergenic
970669956 4:18385144-18385166 TTGAAGCAGAATGAGAAAAATGG + Intergenic
970957886 4:21836487-21836509 TTGAAGTAGAATAAATCGAAGGG - Intronic
971017279 4:22501330-22501352 TTGAAGGAGAACAATGAGAAAGG + Intronic
971854799 4:32029533-32029555 ATGAACTAGAATGCAGAGAATGG - Intergenic
972683380 4:41328536-41328558 GTGAAGATGAATGTGGAGAAGGG + Intergenic
973712519 4:53643636-53643658 GAGAAGGAAAATGAGGAGAAAGG - Intronic
974343243 4:60641202-60641224 TTGAAGTAGAATATGCTGAAAGG - Intergenic
975083379 4:70307541-70307563 TTGAAGTAGATTGAAAGGAAAGG + Intergenic
975433912 4:74328644-74328666 TTGAAGCATCATGTGGAGAAAGG + Intergenic
975471791 4:74778190-74778212 TTAAAGCAGAATGAGGACAATGG - Intronic
975635403 4:76443083-76443105 TTGAATTAGATTGAGAAAAAAGG + Intronic
976119214 4:81761586-81761608 CTGCAGTACAATGAAGAGAAGGG + Intronic
976951667 4:90840243-90840265 GTGGAGAAGAATGAGGAGAAAGG + Intronic
977182402 4:93893067-93893089 GTAAATCAGAATGAGGAGAAAGG + Intergenic
978188865 4:105890385-105890407 TAGATGTAGAATGAAGAGAGTGG - Intronic
978225705 4:106332291-106332313 TTGAGGAAAAATGAGGAGAGGGG - Intronic
978816095 4:112907496-112907518 TGAAAGTAGGATGAGGAGGAGGG - Intronic
978850669 4:113332110-113332132 TTGCAGAAGAAGGAGAAGAATGG - Intronic
978852883 4:113358889-113358911 TTGAGTTAGAATCAGAAGAAGGG + Exonic
979098293 4:116578796-116578818 TTGCTGTAGACTGAGGGGAAGGG + Intergenic
980295207 4:130905375-130905397 ATGAAGGAGAATGAGCAAAAAGG + Intergenic
980484592 4:133439269-133439291 AAGAAGGAGAAGGAGGAGAAGGG + Intergenic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
980763043 4:137261873-137261895 TTGAAGTATAGTGGTGAGAAAGG + Intergenic
980863372 4:138525621-138525643 TTGAAGAGGAATGGTGAGAATGG - Intergenic
981162903 4:141520483-141520505 TGGAAGTAGAAAGAACAGAAAGG + Intergenic
981434441 4:144703576-144703598 TGGAAATAGAGTGAAGAGAAGGG + Intronic
981458480 4:144983919-144983941 TTGACCTAGAATGATGTGAAAGG + Intronic
982085736 4:151834419-151834441 TTGAGGTAGAATGATGGGGAGGG + Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982477052 4:155866618-155866640 TTGAAGTTGAATAAAGACAAAGG - Intronic
982905047 4:161057395-161057417 TTGAAGTAGGATGAGAAGGATGG - Intergenic
983355222 4:166648279-166648301 TTGAATAAGAGTGATGAGAAGGG + Intergenic
983537004 4:168868492-168868514 TGGAAGGAGAATGAGGCCAATGG - Intronic
984374589 4:178911419-178911441 AAGAAGAGGAATGAGGAGAACGG + Intergenic
984666593 4:182435687-182435709 TTGAAATAGAATAGGGAAAAAGG + Intronic
985186811 4:187326548-187326570 TTGAATTAGAATCAAGTGAATGG - Intergenic
985773541 5:1827798-1827820 ATGAAGTGGTATGAGGAGGAGGG + Intergenic
986276657 5:6281223-6281245 GTTAAATAGAAGGAGGAGAAAGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987307417 5:16650353-16650375 TTTATGCAGAATCAGGAGAAGGG + Intergenic
987584089 5:19832107-19832129 GTGAAGTAGAAAGGGGAGGAAGG + Intronic
987767577 5:22253629-22253651 TTGAAAGAGAATGTTGAGAAAGG - Intronic
987941412 5:24543821-24543843 CTGAAGAAAAATGAGGAGAATGG + Intronic
988004232 5:25387211-25387233 TTCAAGTAGAAAGAAGAAAAAGG - Intergenic
988858821 5:35255746-35255768 TGAAAGGAGAATGAGAAGAAGGG - Intergenic
989606588 5:43249760-43249782 CTGAAGGAGACTGTGGAGAAGGG + Intronic
990279152 5:54231242-54231264 GTGAAGGAGAATGAGGAGTCAGG - Intronic
990691099 5:58364859-58364881 TTGAGGATGAAAGAGGAGAATGG - Intergenic
990774935 5:59295761-59295783 CTGAGGTAGGAGGAGGAGAATGG - Intronic
991681037 5:69139666-69139688 CTGAAGTAGAATGACAAGGACGG - Intergenic
991909455 5:71547217-71547239 TTAAAGGAAAATAAGGAGAAAGG - Intronic
992825746 5:80548267-80548289 TTGTAGTTGAATGAGTAGTATGG + Intergenic
993703610 5:91145805-91145827 TTTGAGTAGAAAGGGGAGAAAGG + Intronic
993824632 5:92667628-92667650 TTGAAGAAAAAAGAAGAGAATGG - Intergenic
994337416 5:98584208-98584230 TTGCATTAGAAGGAGAAGAAGGG - Intergenic
994634893 5:102332587-102332609 TTGAGTTAGAGTGAGAAGAAGGG - Intergenic
996119879 5:119659344-119659366 TCTAAGGAGAAGGAGGAGAATGG - Intergenic
996615572 5:125437123-125437145 TTAAAGGAGAATGAGGGTAAAGG - Intergenic
996657146 5:125954440-125954462 TGGAAGTATATTGAGTAGAAAGG - Intergenic
996741074 5:126799474-126799496 CTGAAGTAAAATGATGAAAAGGG - Intronic
997796688 5:136817807-136817829 TTAAAGTTGAATTAGGAAAAGGG - Intergenic
998844143 5:146289608-146289630 CTTAAGTAGAATAGGGAGAAGGG + Intronic
999109151 5:149102263-149102285 TTGGAATAGTTTGAGGAGAATGG - Intergenic
999367512 5:151032815-151032837 TGGAAGAAGAATGATAAGAAGGG + Intronic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
1000724383 5:164751545-164751567 TTGAAGTTGAAAGAGGGCAAAGG - Intergenic
1000730992 5:164833846-164833868 TTGAGGTATAATGATGAGAAGGG + Intergenic
1001310045 5:170604046-170604068 TTGAAGTAGGATGGAGAGGAAGG + Intronic
1001910368 5:175512403-175512425 TTGAAGCAGACTGAGGAGTGCGG + Intronic
1002883768 6:1275660-1275682 TTAGAGTATAATGAGGAAAATGG - Intergenic
1003022889 6:2527377-2527399 TTGAAGAAAAATAAGGAGAGAGG - Intergenic
1003786232 6:9490110-9490132 TAGAAATAGTAAGAGGAGAAGGG + Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1005441998 6:25880100-25880122 TTGGAGTAGATTTAAGAGAAGGG - Intronic
1006503773 6:34475076-34475098 ATAAAGTAGAATCAGGAGATGGG - Intronic
1006827280 6:36944872-36944894 TTGAACTATAATGGTGAGAATGG + Intergenic
1007024728 6:38558940-38558962 TTTCAGTAGAATGGGTAGAATGG + Intronic
1007145923 6:39631322-39631344 TTGAAGAAAAATGGTGAGAATGG + Intronic
1007184587 6:39958230-39958252 GTTAAGTAGACTGAGGAGAAAGG + Intergenic
1007344698 6:41220466-41220488 TTGAATTAGAATGGTGAGAATGG + Intergenic
1007963909 6:45986058-45986080 TGGAAGGTGAATGAGGAGCATGG - Intronic
1008071584 6:47103904-47103926 TTAAAGTAGGAAGAGGAGTATGG - Intergenic
1008660877 6:53666176-53666198 TTCTAGTAGAGTAAGGAGAAGGG + Intergenic
1008806737 6:55438685-55438707 TGTAAGTAGAATGAGGAAAAAGG + Intronic
1009512929 6:64575423-64575445 TTAAAGCAGGATGAGGAGTAAGG + Intronic
1009604808 6:65853428-65853450 TTAAACTAGACTGAGGAAAACGG - Intergenic
1009901393 6:69811791-69811813 ATGAAGGAGAATTAGGAAAACGG + Intergenic
1009956279 6:70458269-70458291 TTGAAAGAGAATGAGAAAAAAGG - Intronic
1010062351 6:71637726-71637748 TTGAATAAGAGTGATGAGAATGG - Intergenic
1010151894 6:72742426-72742448 TAGCAGTAGAAAGAGGAGCAGGG - Intronic
1010429650 6:75764347-75764369 TTGAACAAGACTAAGGAGAAAGG - Intronic
1011377284 6:86703127-86703149 TTGAATAAGAATGAAGAGAGAGG + Intergenic
1012789829 6:103678735-103678757 TTGAAGTAGTAAGAGGAGTTAGG + Intergenic
1012839897 6:104316856-104316878 TTGAGGTAGAATGAGGTGGGGGG + Intergenic
1013618493 6:111867079-111867101 GTGGAGTAGAAAGAGCAGAAAGG - Intronic
1014340520 6:120200557-120200579 TGGGAGTAGAATTAGAAGAATGG - Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1016670283 6:146697094-146697116 ATGAAGAACAATGAAGAGAAAGG + Intronic
1017511322 6:155117000-155117022 TTGAAGTAGACGGGGGAGAAAGG + Intronic
1017569530 6:155729799-155729821 TTGAAGTAGAAAGAGCTGATAGG + Intergenic
1017883462 6:158578874-158578896 TTGAAGTAGAAGGATGGAAAAGG + Intronic
1018427798 6:163699148-163699170 GAAGAGTAGAATGAGGAGAAAGG + Intergenic
1018603276 6:165569662-165569684 TTGAAGTAGATTTAAGAGGAGGG - Intronic
1018853198 6:167655852-167655874 CTGAGCTAGAAGGAGGAGAAAGG + Intergenic
1019186508 6:170223683-170223705 TGGAAGGAGAAAGAGGAGAGGGG + Intergenic
1019927319 7:4201978-4202000 TGGAAGGAGAAAGAGTAGAAGGG - Intronic
1020879476 7:13741680-13741702 CTGAAGTAGACTGAAAAGAAGGG - Intergenic
1021205874 7:17780247-17780269 CTGAACAAGAATGATGAGAATGG - Intergenic
1021211974 7:17864770-17864792 AAGAAGGAGAAGGAGGAGAAGGG + Intronic
1021461535 7:20892634-20892656 GTGAAGTGGAATGAGTAGAAAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022682675 7:32564934-32564956 TTGAAGTGGAATGAGGGAAGTGG + Intronic
1022715645 7:32895534-32895556 TTTAAGTAGTATGAGCAGAAAGG + Intergenic
1022902904 7:34827774-34827796 TCAAAGTAGAGTAAGGAGAAGGG + Intronic
1023128266 7:36976247-36976269 TTGAGGTAGAGTGGGGAAAATGG - Intronic
1023315244 7:38929409-38929431 TTGAAGGAGTTTGGGGAGAAAGG - Intronic
1023541453 7:41270956-41270978 TTGAAGCAGAGGGAGGAAAAAGG - Intergenic
1024791804 7:52973358-52973380 TTCAAGTAGAATTATGGGAAGGG + Intergenic
1025905680 7:65782738-65782760 ATTAAGTAGAATAAGGGGAATGG + Intergenic
1028198579 7:87934775-87934797 CTGAAGAGGAATGGGGAGAATGG + Intronic
1028570909 7:92286118-92286140 TTGGAGAAAAATAAGGAGAATGG - Intronic
1028617385 7:92783868-92783890 TTGATCTGGAATGAGGAGAGGGG - Intronic
1029883443 7:103841440-103841462 CTGAAGTATAATGTGGATAAAGG - Intronic
1029959279 7:104672302-104672324 TGGTAGTGTAATGAGGAGAAAGG - Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1031726562 7:125247144-125247166 TTGATGTGGGGTGAGGAGAAGGG + Intergenic
1032994864 7:137433802-137433824 TTTAAGTGGAAAGATGAGAAGGG - Intronic
1034004785 7:147459280-147459302 TTCAAGCAGAATGTGGAGAGAGG - Intronic
1034244826 7:149636279-149636301 TTGAGACAGAAGGAGGAGAATGG - Intergenic
1034309597 7:150075357-150075379 TTGAATTGGAAAGAGGAGAAGGG - Intergenic
1034406054 7:150903127-150903149 GTGAAGGAGAAGGAGGAGGAGGG - Intergenic
1034682862 7:152943350-152943372 TTGAAGAAGAGTGGGGAGAGTGG + Intergenic
1034797262 7:154025284-154025306 TTGAATTGGAAAGAGGAGAAGGG + Intronic
1035224324 7:157425170-157425192 GTGAAGTAGACTCAGGAGCACGG + Intergenic
1035414695 7:158673211-158673233 TTCAAGGAGAAAGAGGAGCAAGG + Intronic
1035651073 8:1265504-1265526 TTAAAAAAGAATGGGGAGAAAGG + Intergenic
1035963906 8:4168972-4168994 TAGTAGGAAAATGAGGAGAACGG - Intronic
1036645605 8:10610000-10610022 TTGAAGAAACAGGAGGAGAAGGG - Exonic
1037556730 8:20032207-20032229 TAGAAGTAGAGAGAGTAGAATGG - Intergenic
1037637705 8:20715126-20715148 GTGAAGTAGGATAAGGAGAACGG - Intergenic
1037763912 8:21759956-21759978 TTGAGGTAGAATGACTAAAATGG + Intronic
1038151782 8:24948185-24948207 TTGAAGTAGAATTAAAAGATTGG + Intergenic
1038660683 8:29494057-29494079 CTGCATTTGAATGAGGAGAAAGG - Intergenic
1039226502 8:35393963-35393985 ATGAAGGAGAAGGAGAAGAAAGG - Intronic
1040658494 8:49541931-49541953 TTGACATAGAATGTTGAGAAAGG + Intronic
1042130425 8:65582480-65582502 AAGAAGAAGAAGGAGGAGAAGGG + Intergenic
1042144719 8:65715890-65715912 AGGCAGGAGAATGAGGAGAATGG + Intronic
1042186301 8:66139534-66139556 TTGAAGTTAAATCAGCAGAAGGG + Intronic
1042438153 8:68792205-68792227 TAGAATTAGAATGATGAGAAAGG + Intronic
1042873055 8:73415380-73415402 CTGGAGAAGAATGAGGAAAAAGG - Intergenic
1044181906 8:89206459-89206481 TTGAAAAAGAACGAGGATAAAGG + Intergenic
1044216276 8:89614584-89614606 TTGCAGTTTAATGAGAAGAAAGG - Intergenic
1044260231 8:90110959-90110981 TTGAAGTTGAATATGTAGAAAGG + Intergenic
1044394620 8:91696187-91696209 TGGAAGAAGAAGTAGGAGAAGGG - Intergenic
1044616583 8:94148601-94148623 TTAAAGTGGAAGGATGAGAAGGG - Intronic
1046152477 8:110246157-110246179 TTGAATAGGAATGAGGAGAGTGG + Intergenic
1046560870 8:115835932-115835954 TTGAAGAGGAAAGATGAGAAAGG + Intergenic
1046576508 8:116036383-116036405 TTGATGTGGTATGAAGAGAATGG + Intergenic
1046905349 8:119566392-119566414 TTGAAGCAGTATGAGAAGCATGG - Intronic
1047089167 8:121554872-121554894 TTGAATAATAAGGAGGAGAAGGG + Intergenic
1047253741 8:123200328-123200350 TTGAAGTAGAAAAGGAAGAAGGG + Intronic
1047651233 8:126924743-126924765 TTGTAGTAGAATGCCTAGAATGG - Intergenic
1047767784 8:128003341-128003363 GAGAAGGAGAAGGAGGAGAAGGG - Intergenic
1049965867 9:779155-779177 CTGAAATAGTTTGAGGAGAATGG - Intergenic
1050316898 9:4411580-4411602 TTAAAGCAGAATGAGAAGATGGG - Intergenic
1050625816 9:7502603-7502625 GTGAAGTAGAATTATGAGGAAGG + Intergenic
1050861969 9:10446136-10446158 TTGAAATAGAAAGAGGAGAAAGG + Intronic
1051317287 9:15854137-15854159 TTGAAAAAAAATGAAGAGAAGGG - Intronic
1051636145 9:19182598-19182620 CTTAATTAGAATGGGGAGAAGGG + Intergenic
1052020976 9:23524892-23524914 TCAAAGTAGAGAGAGGAGAAGGG - Intergenic
1052366503 9:27617772-27617794 TAAAAGTAGTATGAGAAGAAGGG + Intergenic
1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG + Intergenic
1053134530 9:35641979-35642001 GGGAACTAGAATTAGGAGAAGGG - Intronic
1053314860 9:37042522-37042544 TTGAATTAAAATGAGAGGAAGGG - Intergenic
1053560550 9:39189541-39189563 CTGAAGTCTAATGAGGAAAAAGG + Intronic
1054136569 9:61429414-61429436 CTGAAGTCTAATGAGGAAAAAGG - Intergenic
1055868232 9:80841611-80841633 TAGGAGTAGAGTGAGGAGGAGGG - Intergenic
1056082252 9:83107694-83107716 TTTAAATACAAAGAGGAGAATGG - Intergenic
1056967840 9:91179371-91179393 TGGAAGTAGAATGAACAGACCGG - Intergenic
1057936602 9:99244887-99244909 AGGAAATAGAGTGAGGAGAAGGG + Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1059509152 9:114827897-114827919 TTGGAGTAGGAGGAGGATAAGGG - Intergenic
1059622942 9:116028677-116028699 TGGAAATAGAATGAAGGGAATGG - Intergenic
1059634984 9:116161457-116161479 TTTAAGTGGAATAAGGTGAAGGG - Intronic
1059898353 9:118893913-118893935 TTGAATTATAAAGGGGAGAAGGG - Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1061214665 9:129214466-129214488 TGGAAGTAGAGGCAGGAGAATGG + Intergenic
1061337852 9:129953805-129953827 TAGAAGGAGAAGGAGGGGAATGG + Intronic
1061477935 9:130881449-130881471 CTGAAGGTGAATGAGGAGCAAGG + Intronic
1062007388 9:134247081-134247103 TTGAACTAGAAAGAGTAAAAAGG + Intergenic
1203532403 Un_GL000213v1:158691-158713 TTGAATAAGAATGGTGAGAAAGG + Intergenic
1203363687 Un_KI270442v1:239004-239026 GGGAAGTAGAATAAGGAGAAGGG + Intergenic
1187016923 X:15338426-15338448 TTGAAGCAGAATCAGGAGTTAGG - Intergenic
1187266226 X:17736904-17736926 TTGACTTGGAATGAGGAGAGGGG - Intergenic
1187357814 X:18594363-18594385 TTTAAATAAAATGAGGGGAAGGG - Intronic
1187632146 X:21185277-21185299 TTGAAGAAGAATGAGGAATCAGG - Intergenic
1187762697 X:22605400-22605422 TTGAGGTAAATTAAGGAGAAGGG + Intergenic
1187930519 X:24289570-24289592 ATGAAGGTGAAGGAGGAGAAAGG + Intergenic
1188207475 X:27378315-27378337 AGGCAGCAGAATGAGGAGAATGG + Intergenic
1188376785 X:29441009-29441031 TTGAAGGAAAATGAGAAAAAAGG - Intronic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1189221583 X:39376697-39376719 TAGAAGCAGAGTGGGGAGAAAGG + Intergenic
1189853401 X:45199339-45199361 TTGAGGAAGATGGAGGAGAAAGG + Intronic
1190065133 X:47234996-47235018 TTGAAATAGATTGAGAAAAATGG - Intronic
1190215562 X:48477506-48477528 ATGAAGTAGTATTAGGATAAAGG + Intronic
1190332462 X:49244271-49244293 AAGAAGTAGACAGAGGAGAAGGG - Intronic
1190369672 X:49728393-49728415 TTGAAGAAGAATGATGAGAGTGG + Intergenic
1191796513 X:65027181-65027203 ATGAAGTAGAATGTAGAGAATGG + Intronic
1191994396 X:67075901-67075923 TTGAAGTTGAGTGGTGAGAATGG - Intergenic
1192047681 X:67693784-67693806 TTGAACTGGACTGAGAAGAATGG - Intronic
1193600780 X:83507007-83507029 TGGAAGCAGAGTGGGGAGAAAGG - Intergenic
1193682883 X:84542761-84542783 TTGTAGTAGCAGGAAGAGAACGG + Intergenic
1194069765 X:89307264-89307286 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1194596872 X:95869144-95869166 TTGGAGTAGTAGGAGGAGATGGG + Intergenic
1194912301 X:99661363-99661385 TTGAAGTAGCAGGTGAAGAAGGG - Intergenic
1195401792 X:104468645-104468667 TTGAAGTAGTCTGTGGAGAGTGG + Intergenic
1195656093 X:107332829-107332851 TGAAAGAAGAAGGAGGAGAAAGG - Intergenic
1195746567 X:108124342-108124364 TTAAAATATATTGAGGAGAAGGG + Intronic
1196301101 X:114050669-114050691 TTAAAGAAGAATGAAGGGAAAGG + Intergenic
1196436054 X:115675635-115675657 TTGATGTAGAAAGAGCAGAGAGG - Intergenic
1197044885 X:121984013-121984035 TTGAAGTGGGATGATGAGACTGG + Intergenic
1198512618 X:137368643-137368665 TTGAAGTAGGAAGAGAAAAAAGG - Intergenic
1198571054 X:137957446-137957468 TTGAAGTAAAGTGAAGAAAAGGG - Intergenic
1199265146 X:145819877-145819899 TAGAAGAAGAAGAAGGAGAAAGG + Exonic
1199503151 X:148531519-148531541 ATGAAGTAGAAGGAGGAGCATGG + Intronic
1199543482 X:148983279-148983301 TGGAAAGAGAATGAAGAGAATGG + Intronic
1200723912 Y:6641400-6641422 TTGAAAAAGAGTTAGGAGAATGG + Intergenic
1201074634 Y:10177826-10177848 GGGAAGTAGAATAAGGAGAAGGG - Intergenic
1201136367 Y:10993093-10993115 GTGGAGTGGAATGAGTAGAATGG - Intergenic
1202083703 Y:21112571-21112593 TTGAAAGAGAGTGAGGAGAGAGG + Intergenic
1202579662 Y:26366613-26366635 CTGAGGTAGAATGAACAGAAAGG - Intergenic