ID: 945274561

View in Genome Browser
Species Human (GRCh38)
Location 2:207975298-207975320
Sequence TTCAAAACGTGGGTTTTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945274557_945274561 11 Left 945274557 2:207975264-207975286 CCATAGAAAAGACTAGCATCATA 0: 1
1: 0
2: 1
3: 11
4: 233
Right 945274561 2:207975298-207975320 TTCAAAACGTGGGTTTTCAATGG 0: 1
1: 0
2: 3
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945274561 Original CRISPR TTCAAAACGTGGGTTTTCAA TGG Intronic
901354769 1:8635598-8635620 TTCAAAACGTAATTTTTCCAAGG - Intronic
903311436 1:22460646-22460668 TTCAAAACCTGTTTTCTCAAGGG - Intronic
903877147 1:26482780-26482802 TTAAAAACTTGGTTTGTCAAAGG - Intergenic
909726455 1:78841557-78841579 TTTAATAAGTGGGTTTTAAAAGG + Intergenic
909792398 1:79695459-79695481 TTCAAAACATGAGTTTTGAAGGG + Intergenic
910028312 1:82685343-82685365 TTCAAATCTTTGTTTTTCAAAGG - Intergenic
910285754 1:85552331-85552353 TTAAAAACCTGGTTTCTCAACGG + Intronic
916099149 1:161378886-161378908 TTCAGAATGTGTGTTTTCCATGG + Intergenic
917049985 1:170911050-170911072 TTCAAAACATTGTTTTTCAAAGG + Intergenic
919275872 1:195416020-195416042 TTCAAAACCAGGTTGTTCAAGGG + Intergenic
919634516 1:199990393-199990415 TTCAAAACATGTTTTTTCACAGG - Intergenic
921153509 1:212420034-212420056 TTCAATTCGGGGGTTTTCAAGGG + Intergenic
921689314 1:218129824-218129846 TTCCAAAGGTGGTTTTTCCAAGG + Intergenic
1065900833 10:30206539-30206561 TTCCAATAGTGGGTTTTTAATGG - Intergenic
1067908062 10:50314976-50314998 TTCAAAACCTGGTCTTTCTAGGG + Intronic
1069466647 10:68645622-68645644 TGCAACACGGTGGTTTTCAATGG + Exonic
1072172973 10:92885184-92885206 TTGAAAACTTTGGTTTTCAAGGG + Intronic
1072831177 10:98660499-98660521 TTAAAAACGTAGATTTTAAAAGG + Intronic
1075903724 10:126063412-126063434 CTCGAAGCCTGGGTTTTCAATGG - Intronic
1078363665 11:10689683-10689705 TCCAAAACATGATTTTTCAATGG - Intronic
1078616206 11:12868398-12868420 TTAAAAACATGGGCTTTAAATGG - Intronic
1078636765 11:13058127-13058149 TTCAAATCATGGCTTTTCTATGG - Intergenic
1082927608 11:58566835-58566857 TTTACAAAGTGGTTTTTCAAAGG + Intronic
1085398884 11:76223471-76223493 TTAAAAACGTTGTGTTTCAAAGG - Intergenic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1088127176 11:106442033-106442055 TTGAGAACCAGGGTTTTCAATGG - Intergenic
1088472376 11:110199867-110199889 TTCTAATCGTGGAGTTTCAAAGG - Intronic
1092749284 12:11703398-11703420 TTTGGAACATGGGTTTTCAAAGG + Intronic
1093738898 12:22658163-22658185 TTCAAAAAGAGGGATTTCAGGGG + Intronic
1095382499 12:41612460-41612482 TTAAAAACCAGGGTTTCCAAAGG + Intergenic
1095643217 12:44509426-44509448 TTCAACATGTGGGTTTTAAGAGG - Intronic
1095734456 12:45541369-45541391 TTCAAAACCTGGGTTTGCAATGG - Intergenic
1099824898 12:87762664-87762686 TTCAAACCTTTGGTTTTCAAGGG - Intergenic
1100181489 12:92091133-92091155 TTCATTTCTTGGGTTTTCAATGG + Intronic
1101232984 12:102760753-102760775 TTGAAAATGTGGGATTTCACTGG + Intergenic
1103298506 12:119908524-119908546 CACAAAACCTGGATTTTCAAAGG - Intergenic
1107617723 13:42188465-42188487 TTCAAAGCTTTGGTTTGCAAAGG - Intronic
1108895819 13:55326673-55326695 TTTAATATGTGTGTTTTCAAAGG - Intergenic
1111376104 13:87380585-87380607 TTCAAAATGTGGGGGTTCCAGGG + Intergenic
1111501065 13:89120402-89120424 ATCATAACTTGGGTTTTTAAAGG + Intergenic
1113014726 13:105815892-105815914 TGCAAAACCTGGGCTTTCAATGG - Intergenic
1114766325 14:25374676-25374698 TTCAAAATGAGATTTTTCAAAGG + Intergenic
1115259825 14:31440645-31440667 TTCAACATATGGGTTTTAAAAGG + Intronic
1118639287 14:67777427-67777449 TTCAGAACTTGCCTTTTCAATGG - Intronic
1124449791 15:29777131-29777153 CTGAAAACGTGTGTATTCAAGGG + Intronic
1126355549 15:47791783-47791805 TTCAAATAGTGGTTTCTCAAAGG - Intergenic
1126821369 15:52507278-52507300 TTCTAAACGAGGGCTTTTAAAGG - Intronic
1127211260 15:56777139-56777161 TCCAGAATGAGGGTTTTCAAGGG - Intronic
1127562572 15:60154181-60154203 CTCAAAACCTAGGTTTTTAATGG + Intergenic
1127670352 15:61188697-61188719 TTCAAAACATGGGTCCACAATGG + Intronic
1129610409 15:77050269-77050291 TTAAAAACTTGGGTTTTAAGGGG - Intronic
1131585664 15:93690219-93690241 TTCAAAATGTGAGTTTGGAAAGG - Intergenic
1137954834 16:52818898-52818920 TGCAAAATGTGATTTTTCAATGG - Intergenic
1140150916 16:72364370-72364392 TTCAAAACATGTTTTTTCAGCGG + Intergenic
1142879696 17:2874729-2874751 AGCTAAACGTGGGGTTTCAAGGG - Intronic
1143888422 17:10084197-10084219 TTAAAAATATGGGTTATCAATGG + Intronic
1149152918 17:53591696-53591718 TTCAATCCATGGCTTTTCAACGG - Intergenic
1150081845 17:62246933-62246955 TTCAAAATGTTATTTTTCAATGG - Intergenic
1153170176 18:2307405-2307427 TGAAAAACGTGTGTTTGCAAAGG + Intergenic
1155585749 18:27362406-27362428 TTCAATACATGAATTTTCAAAGG + Intergenic
1157915122 18:51656792-51656814 TTCAAGATATGGGTTATCAATGG + Intergenic
1157921369 18:51716094-51716116 TTCAGAATTTGGCTTTTCAATGG + Intergenic
1159024511 18:63170314-63170336 CTAGAAACTTGGGTTTTCAATGG + Intronic
1159168096 18:64726894-64726916 TTAAACAAGTGGATTTTCAATGG + Intergenic
1159677359 18:71302429-71302451 TTCAAAAGATGAGTTTTTAATGG - Intergenic
1159796933 18:72855300-72855322 TTCAAATCCTGGGTCTTCAAAGG - Intronic
1164494749 19:28749771-28749793 TGCAAAAGGTGGGTTTACATGGG + Intergenic
927004379 2:18833052-18833074 TTCAAAACATGAATTTTGAAGGG - Intergenic
930171156 2:48252850-48252872 CTAAAAACTTGGGTTTTAAAGGG + Intergenic
930420198 2:51141745-51141767 TTCAAAACATTGCTTTTCATGGG - Intergenic
930968250 2:57359195-57359217 TTCAATAAGTGTATTTTCAATGG - Intergenic
931432164 2:62216750-62216772 TGCAAAACCATGGTTTTCAAGGG - Intronic
933098378 2:78217628-78217650 TGCAAAACATGAGTTTTCACAGG - Intergenic
933346976 2:81099876-81099898 TTCAAACCGTTGTTGTTCAAGGG + Intergenic
939710816 2:145517277-145517299 TTATAACCTTGGGTTTTCAATGG + Intergenic
940569118 2:155407508-155407530 TTCAGTATGTGGGTTTTCTAGGG + Intergenic
940898193 2:159101560-159101582 TTCAAAACTTTTGTTTTTAATGG + Intronic
942101289 2:172586638-172586660 TTCAAAATGTGGTTTTACACAGG - Intronic
945274561 2:207975298-207975320 TTCAAAACGTGGGTTTTCAATGG + Intronic
945735284 2:213591271-213591293 TTCAAAACAGGGCTTTTTAAGGG - Intronic
946897947 2:224344107-224344129 TTCAAAACCATGGTTTACAAAGG - Intergenic
949066089 2:241991075-241991097 TTCAACACGTGGGTTTTGAGGGG + Intergenic
1169567477 20:6870898-6870920 TTCAAAACATCGGTTTTTCATGG - Intergenic
1172506092 20:35463813-35463835 TTCCAACCCTTGGTTTTCAAAGG + Intronic
1175247735 20:57591763-57591785 TTCTAAAAGTGGGTTTTGATGGG + Intergenic
1175431979 20:58911768-58911790 TTAAAACCTTGGGTTTTTAAAGG + Intergenic
1175668299 20:60879111-60879133 TTCAGAGCTTGGGTGTTCAAGGG + Intergenic
1184897598 22:47420562-47420584 TTCAAAACTGGGGTATTTAATGG - Intergenic
949751831 3:7360882-7360904 TTCAAAACGTAAGATTTCATGGG - Intronic
951670564 3:25176917-25176939 TTCAAACCCTCGCTTTTCAAAGG - Intronic
952650248 3:35717770-35717792 TTCAAACAGTGTGTTTTCAAGGG + Intronic
954339952 3:49945500-49945522 TTCAACACGTGAATTTTCAGGGG - Intronic
955812140 3:62802651-62802673 TTCAATACCTGGGATTTTAAAGG - Intronic
956116959 3:65928736-65928758 TTGAAAACGTAGGTTTTAAAAGG - Intronic
956614124 3:71153854-71153876 TTCTAAAGGTGTGTTTTCAGAGG + Intronic
957428389 3:80069761-80069783 TTCAACACGTGAGTTTTGGAGGG + Intergenic
957569908 3:81933312-81933334 TTAACAACGTGAGATTTCAAGGG - Intergenic
957774357 3:84736588-84736610 TTCAAAATGTGTGATTTCACAGG + Intergenic
959277006 3:104288584-104288606 TTCAAAATGTGAATTTCCAAAGG - Intergenic
959381223 3:105643087-105643109 TTCATAACTTGGCTTTTCAAGGG + Intergenic
959980830 3:112515250-112515272 TTTCAAACCTGTGTTTTCAATGG + Intergenic
960222928 3:115136860-115136882 TTAAAAACATGAGTGTTCAAAGG + Intronic
963163040 3:142172058-142172080 TTCAAAATTTGGATTTTCAAAGG - Intronic
963291473 3:143494443-143494465 TCCAAAACCTGGATTTTAAAAGG - Intronic
967309363 3:188091478-188091500 TTCAAAAAGCAGGTTTTCAAAGG - Intergenic
967455846 3:189685616-189685638 TTCAATACATGTGTGTTCAATGG + Intronic
967814503 3:193787670-193787692 GTCATGACGTGGGTCTTCAAGGG + Intergenic
967933311 3:194706494-194706516 TTCAAACCCACGGTTTTCAACGG - Intergenic
969443018 4:7228344-7228366 TTCAACAGGTGGGTTTTGAGGGG + Intronic
970524376 4:16916731-16916753 TTAAAAAGGCGGGTTATCAATGG - Intergenic
971217377 4:24673885-24673907 TTCAGAATGTGGGTGTTGAAGGG + Intergenic
971555339 4:28006510-28006532 TTCAAATCCTGGTTGTTCAAAGG + Intergenic
972066804 4:34956582-34956604 TCCAAAACCTGGGTCATCAATGG - Intergenic
975883413 4:78938312-78938334 TTTAAAACACGGATTTTCAAGGG + Intronic
977022438 4:91774302-91774324 TTCTAAAGGTGGGTTTTTATAGG + Intergenic
977094871 4:92728473-92728495 TTCACCACGTGGGTCTTCCATGG + Intronic
977115526 4:93020570-93020592 TTTAAAATGTGGGTTTAAAATGG + Intronic
978951077 4:114560197-114560219 TTCATTATGTGGGTTTTTAAGGG - Intergenic
981079605 4:140625699-140625721 TTGAAAATGTGGTTTTTAAATGG - Intronic
983289773 4:165787010-165787032 TTCAAAACATGGGTTTTGGGGGG + Intergenic
983762065 4:171423284-171423306 TTCAAACCTGTGGTTTTCAAAGG - Intergenic
985342431 4:188969368-188969390 TTCAAAATGGGAATTTTCAAGGG + Intergenic
985998161 5:3609004-3609026 TTGAAAACATGGGGCTTCAAAGG + Intergenic
986148063 5:5098996-5099018 TTCACAAAGTGAATTTTCAATGG + Intergenic
986670633 5:10140016-10140038 TTCAACACGTGAGTTTTGAGGGG - Intergenic
986707923 5:10466707-10466729 CTCAAAAAGTGGGTTTTCTTGGG + Intronic
986910487 5:12549604-12549626 TTAAAAACGTGGATTTTGGAGGG + Intergenic
987004988 5:13701351-13701373 TTTACCTCGTGGGTTTTCAATGG - Exonic
990249360 5:53896882-53896904 TAGAAAACGTCGGTCTTCAAAGG + Intronic
990678010 5:58210255-58210277 TTTAAATGGTGGGTTTTCTATGG + Intergenic
991416095 5:66394367-66394389 TTCAAAATGTGACTTTTAAAAGG - Intergenic
991659297 5:68934096-68934118 GGCCAAACGTGGGTTTTCTAAGG + Intergenic
992180439 5:74191992-74192014 TTAAAAAATTGGGATTTCAAAGG - Intergenic
992385664 5:76282061-76282083 TTCAGAAGGTAAGTTTTCAAAGG - Intronic
993002225 5:82392662-82392684 TTGAAAAAGTGATTTTTCAAAGG - Intergenic
993135908 5:83963922-83963944 TTCTAAAAGGGGGTTTTCACTGG - Intronic
993382455 5:87223386-87223408 TGGAAAAAGTGGATTTTCAATGG + Intergenic
994082815 5:95727097-95727119 TTAAAAAGATGGGTTTTCTAAGG - Intronic
995089656 5:108159383-108159405 TTCAAAATATGAGTTTTCAGGGG - Intronic
997609420 5:135204378-135204400 GTGAAAACATTGGTTTTCAAAGG + Intronic
999885243 5:155915363-155915385 TTTAAACCATGCGTTTTCAATGG - Intronic
1000793650 5:165637787-165637809 TTCAAATCTTGGGTTTACCATGG + Intergenic
1002203759 5:177548496-177548518 TTCAAACAGTGGGTTTCCCAGGG - Intronic
1003761790 6:9186772-9186794 TTCAAATACTGGCTTTTCAATGG - Intergenic
1005584441 6:27261898-27261920 TTCCACACTTGGGTTTTCACCGG + Intergenic
1009810142 6:68651900-68651922 TTGAAAACATTAGTTTTCAATGG - Intronic
1012447595 6:99322539-99322561 TGCAGAAGGTGGGTTTTCACTGG - Intronic
1013245237 6:108280172-108280194 TTCAAAACATTGGTTTTCGTAGG + Intergenic
1014849556 6:126324669-126324691 TTCAAAACATGGATTTAGAAAGG + Intergenic
1016375814 6:143419525-143419547 TCCAAAATGTTGGTTTCCAATGG + Intergenic
1017455859 6:154600904-154600926 TTCAAGGTGTGGTTTTTCAAGGG - Intergenic
1019695702 7:2445058-2445080 TTCAACATGTCGGGTTTCAAAGG + Intergenic
1019902047 7:4028596-4028618 CTCCAAACGTGTGTTTTCACTGG - Intronic
1020232474 7:6330491-6330513 TTGAAAACATGGGCTTTAAACGG + Exonic
1023534206 7:41191107-41191129 TTCAATATGTGAGTTTTGAAGGG - Intergenic
1024179692 7:46879084-46879106 TTCAAAACGGGAGTTTCCCATGG - Intergenic
1028352585 7:89867338-89867360 TTTAAAACATGGGTACTCAAAGG - Intergenic
1031551492 7:123119327-123119349 TTTAGAAAGTGAGTTTTCAAAGG - Intronic
1034038782 7:147854462-147854484 TTCAAAAAGTAGGGTTTGAAGGG - Intronic
1035701365 8:1641340-1641362 TTGAAAACGGTGGTTTTGAAGGG - Intronic
1035733366 8:1869074-1869096 TTCAAAAAGTTGGTTTATAAGGG - Intronic
1036065492 8:5376604-5376626 TGCATAACGTGGATTTGCAAAGG + Intergenic
1040600601 8:48880144-48880166 TTGAAAATGTGGGCTTCCAAAGG + Intergenic
1042361816 8:67892193-67892215 AACAAAACGTGGGGTTTCACTGG - Intergenic
1042394108 8:68271245-68271267 TTCAAAATCTGTGGTTTCAATGG + Intergenic
1042669798 8:71249130-71249152 TTCAAAACGTGGCCTTTCTGTGG + Intronic
1042908230 8:73796606-73796628 TTCAAAACGAGGGTATTCAAAGG - Intronic
1045335271 8:101196578-101196600 TTAAAAACATGGGTTTTCCTAGG + Intronic
1047641417 8:126825564-126825586 TTCCAAAGGTTGGTTTTCAAGGG + Intergenic
1049026102 8:139990088-139990110 TTCAAAACATGGCCTTCCAAAGG + Intronic
1052418992 9:28217534-28217556 TTCAAAAAGTGTCTTTTCTATGG - Intronic
1053166927 9:35851501-35851523 TTGAAAAAGTGAGTTCTCAATGG - Intronic
1053493324 9:38527720-38527742 TTGAAAACATGGGGTTTAAAAGG - Intergenic
1056674078 9:88658468-88658490 CTCAAAACCTGGGTTTTCAATGG + Intergenic
1057053889 9:91947157-91947179 TTTAAAATGTGCGTTTTCCAGGG - Intronic
1057674011 9:97122298-97122320 TTGAAAACATGGGGTTTAAACGG - Intergenic
1058624408 9:106919597-106919619 TTCAAAATGTGGGGTTTTGATGG - Intronic
1059822482 9:117989291-117989313 TTCAACATGTGGATTTTGAAAGG + Intergenic
1060647265 9:125291658-125291680 TTCAAAGCTGGGGTTTTTAATGG + Intronic
1186183996 X:7002337-7002359 TGCATATGGTGGGTTTTCAATGG + Intergenic
1190093070 X:47456619-47456641 TTCAAAATGAGGATTTTAAATGG + Intronic
1197253811 X:124241744-124241766 TTCAAAAAGAGGTTTTTCAGTGG - Intronic
1197308750 X:124878108-124878130 TTCAAAACTTTGTTGTTCAAGGG + Intronic
1201640890 Y:16175643-16175665 TTCAAACCGATGCTTTTCAAGGG + Intergenic
1201661926 Y:16409683-16409705 TTCAAACCGATGCTTTTCAAGGG - Intergenic