ID: 945275530

View in Genome Browser
Species Human (GRCh38)
Location 2:207983910-207983932
Sequence CCACTTCACCCACTGTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
945275522_945275530 13 Left 945275522 2:207983874-207983896 CCACCTTCATCAAGGTTGAGTCC 0: 1
1: 0
2: 1
3: 30
4: 148
Right 945275530 2:207983910-207983932 CCACTTCACCCACTGTTGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 208
945275519_945275530 25 Left 945275519 2:207983862-207983884 CCATCCTCATGGCCACCTTCATC 0: 1
1: 0
2: 5
3: 44
4: 553
Right 945275530 2:207983910-207983932 CCACTTCACCCACTGTTGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 208
945275523_945275530 10 Left 945275523 2:207983877-207983899 CCTTCATCAAGGTTGAGTCCTCC 0: 1
1: 0
2: 1
3: 6
4: 126
Right 945275530 2:207983910-207983932 CCACTTCACCCACTGTTGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 208
945275520_945275530 21 Left 945275520 2:207983866-207983888 CCTCATGGCCACCTTCATCAAGG 0: 1
1: 0
2: 2
3: 21
4: 190
Right 945275530 2:207983910-207983932 CCACTTCACCCACTGTTGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 208
945275525_945275530 -8 Left 945275525 2:207983895-207983917 CCTCCTCCTTCCTGGCCACTTCA 0: 1
1: 0
2: 2
3: 53
4: 648
Right 945275530 2:207983910-207983932 CCACTTCACCCACTGTTGCCAGG 0: 1
1: 0
2: 2
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
945275530 Original CRISPR CCACTTCACCCACTGTTGCC AGG Intronic
900353157 1:2246874-2246896 CCACCTCGCCCACTGTGGCCAGG + Intronic
900396548 1:2455406-2455428 GCGGTTCACCCACTGTTCCCAGG + Intronic
900636619 1:3669219-3669241 CCACTGCACCCACGGTGGCAAGG - Intronic
901724878 1:11233403-11233425 CCAATTCTCCTATTGTTGCCAGG + Exonic
902869119 1:19302763-19302785 CCACTGCAACCTCTGTTTCCGGG + Intergenic
905759990 1:40548311-40548333 TCACTGCAACCTCTGTTGCCTGG + Intergenic
906865446 1:49413475-49413497 CAATTCCACCCATTGTTGCCAGG - Intronic
911461638 1:98198389-98198411 CCATCACACTCACTGTTGCCAGG + Intergenic
912522675 1:110256670-110256692 CCACTACAACCACTGTGACCGGG - Intronic
912605866 1:110987656-110987678 CCACTTCAGCCCCTGTTAACAGG + Intergenic
913448588 1:118976018-118976040 CACCTTCTCCCTCTGTTGCCAGG + Intronic
918077439 1:181181325-181181347 TCACTGCACCCACTGTCTCCTGG + Intergenic
921901755 1:220458256-220458278 CCACTTCACCCACTGATTCCAGG - Intergenic
923289680 1:232532134-232532156 CCCCATCACCCTCTCTTGCCTGG - Intronic
1063059897 10:2539994-2540016 TCACTTCACCCAGTGTTGGGAGG - Intergenic
1066359553 10:34717024-34717046 CCACTTCTTCCAGTGTGGCCCGG + Intronic
1067067709 10:43113030-43113052 GCACTTCAGCCAGAGTTGCCAGG + Intronic
1069300411 10:66900219-66900241 CCACTCCAGCCCCTTTTGCCTGG - Intronic
1070985109 10:80682392-80682414 TCACTGCAACCTCTGTTGCCTGG + Intergenic
1073012641 10:100373365-100373387 CCTCTCCACCCACTCTCGCCGGG + Intergenic
1073434514 10:103508111-103508133 CCACTTTCCCAGCTGTTGCCTGG - Intronic
1074746811 10:116542662-116542684 AAAATTCACCCAGTGTTGCCTGG - Intergenic
1074885638 10:117690866-117690888 TCACTGCAACCACTGTTCCCTGG + Intergenic
1075409377 10:122216082-122216104 CCACTGCCCCCACTCTGGCCAGG - Intronic
1075740661 10:124694120-124694142 CCGCTTCTCCCTCTGCTGCCTGG + Intronic
1076463237 10:130660533-130660555 CCACATCACCCCCAGCTGCCTGG + Intergenic
1076706411 10:132304342-132304364 CCAGTTCACCCACAGTTCACGGG + Intronic
1079023109 11:16925027-16925049 CCTCTACACCCACACTTGCCAGG - Intronic
1081540752 11:44032953-44032975 CGACTCCTCCCACTGTCGCCAGG - Intergenic
1082918240 11:58463129-58463151 CCACTTCTCCCACTGGAGGCAGG + Intergenic
1083627498 11:64079091-64079113 CCACTGCACCATCTCTTGCCAGG - Intronic
1084120706 11:67067326-67067348 GCCCCTCACCCACTGCTGCCAGG + Intronic
1084426088 11:69085273-69085295 CCACCTCACCTGCTGTTTCCAGG - Exonic
1084642229 11:70432800-70432822 CCCCTGCCCACACTGTTGCCTGG - Intronic
1084778347 11:71392206-71392228 CCACCTAACCTGCTGTTGCCTGG + Intergenic
1085338458 11:75715541-75715563 CCAAATCTCCCACTGTCGCCCGG - Intergenic
1085375736 11:76059503-76059525 AGACATCACCCAATGTTGCCTGG - Intronic
1085400640 11:76233709-76233731 CCCCTGCACTCCCTGTTGCCTGG - Intergenic
1089731905 11:120524579-120524601 CCCCTTGACCCATTGATGCCAGG - Intronic
1090058092 11:123440432-123440454 TCACTGCAACCACTGTTTCCCGG - Intergenic
1094783334 12:33818251-33818273 CCTCACCACCCACTGCTGCCAGG - Intergenic
1098685528 12:73415236-73415258 ACACTTCACACAGTGTTCCCAGG + Intergenic
1098817709 12:75188817-75188839 CCACTGCACTCACTGCAGCCTGG + Intronic
1102282042 12:111626131-111626153 CCACTGCACTCACTCTAGCCTGG - Intergenic
1102480715 12:113221480-113221502 CCACTTCAGCCACTGCCACCAGG - Exonic
1103942906 12:124510601-124510623 CCAGCTCACCCACTGTGTCCTGG + Intronic
1104957654 12:132474348-132474370 CCACTTCATCCCCTGCCGCCAGG + Intergenic
1105243842 13:18630054-18630076 CTACTGCAACCACTGTTGCCCGG + Intergenic
1105448617 13:20478776-20478798 CCTCTTCTCGCTCTGTTGCCAGG + Intronic
1106275239 13:28198244-28198266 CCACTGCACCCACTCCAGCCTGG + Intronic
1106622050 13:31379986-31380008 CCCCTTCCCCTACTGTAGCCAGG - Intergenic
1106846066 13:33738902-33738924 TCACTGCAACCTCTGTTGCCCGG - Intergenic
1107016440 13:35711451-35711473 CAAGTTCAACCACCGTTGCCAGG + Intergenic
1107444849 13:40461058-40461080 CACCTTCACCCACTGTCCCCAGG + Intergenic
1110890385 13:80690491-80690513 CCACTCCAGACCCTGTTGCCTGG - Intergenic
1112374334 13:98824931-98824953 TCACCTCACCCACTCTGGCCAGG + Intronic
1113739105 13:112698759-112698781 CCACTGCACCCACTCCAGCCTGG - Intronic
1113807531 13:113118349-113118371 CCACCTCACCCCCTGGTGCATGG - Intronic
1114649138 14:24272064-24272086 TCACTTCACCCACTGTTCCTGGG + Intergenic
1115951838 14:38730200-38730222 CCACTTCAGACACTGGTGCAAGG + Intergenic
1116433840 14:44875233-44875255 CCACTTCACTCACTCCAGCCTGG + Intergenic
1116959199 14:50952620-50952642 CCACTGCACTCACTCTAGCCTGG + Intergenic
1118942619 14:70352209-70352231 CCAAGTCTCCCTCTGTTGCCTGG + Intronic
1119746271 14:77046436-77046458 CTGCTGCACCCACTGTGGCCAGG + Intergenic
1121709752 14:96028825-96028847 CCAGTTTCCTCACTGTTGCCGGG - Intergenic
1121879409 14:97486812-97486834 CCACTTCTCTCACGGATGCCTGG - Intergenic
1122292750 14:100688340-100688362 CCACCTCACCCTCTGCTTCCTGG + Intergenic
1124218963 15:27832885-27832907 TCACTGCACCCTCTGTTTCCCGG + Intronic
1125117401 15:36111199-36111221 CCACTTCACCCACAGGTGTTAGG + Intergenic
1125215091 15:37263069-37263091 CAATTTCACTCACTGTTCCCTGG + Intergenic
1127236310 15:57056531-57056553 TCACTGCACCCACTGCTTCCCGG + Intronic
1128146688 15:65335909-65335931 CCTCCTCACCCACGGTGGCCTGG + Exonic
1129262604 15:74377153-74377175 CCACTCCACCTGCTGTGGCCAGG + Intergenic
1131677528 15:94685458-94685480 CCACTGCACTCACTCTAGCCTGG + Intergenic
1133037352 16:3041213-3041235 TCACTTCAACCTCTGCTGCCCGG - Intergenic
1133118052 16:3589461-3589483 CCACTTCACCCGCTGGGGTCTGG + Exonic
1133882123 16:9792191-9792213 CCAACTCAACCAATGTTGCCTGG - Intronic
1134640480 16:15825989-15826011 TCACTTAACCCTCTGTTGCTTGG - Intronic
1134787543 16:16958767-16958789 GAACTTCACCCACTGTTCTCAGG + Intergenic
1135920629 16:26645910-26645932 CCCCTTCTCCCGCTGCTGCCTGG - Intergenic
1138017968 16:53448230-53448252 CCACTGCAACCTCTGCTGCCCGG + Intronic
1138091476 16:54178117-54178139 CCTCTTCGCCCACTGTAGCCAGG + Intergenic
1139077060 16:63464423-63464445 TCACGTCTCACACTGTTGCCTGG + Intergenic
1141722561 16:85764977-85764999 CCACATCACCCACTGGCGCTTGG + Intergenic
1141795684 16:86272061-86272083 CCACTTCACCCAGTGTCTCTGGG - Intergenic
1144453470 17:15400052-15400074 CCACTGCACTCACTCTAGCCTGG + Intergenic
1145044812 17:19605265-19605287 CTACTTCTCCCACTGTTGCGGGG + Intergenic
1146124110 17:30218480-30218502 CCACTTTTCCCACGGTGGCCTGG - Intronic
1146386673 17:32383075-32383097 CCACTGCACTCGCTGGTGCCCGG + Intergenic
1147181079 17:38686100-38686122 CCACTCCACCCCCTCTTCCCAGG + Intergenic
1148894952 17:50834197-50834219 CCACTCCACCTACTGTCCCCGGG + Intergenic
1149823564 17:59804573-59804595 CCACTTCACTCACTGCAGCCTGG + Intronic
1151649672 17:75458649-75458671 CCACTGCACTCACTCTAGCCTGG + Intronic
1151966651 17:77434971-77434993 CCACTCCTGCCACGGTTGCCAGG - Intronic
1154445100 18:14429839-14429861 CTACTGCAACCACTGCTGCCCGG - Intergenic
1155957862 18:31968618-31968640 CCACTGCACCCTCTGCTTCCTGG - Intergenic
1156337327 18:36183361-36183383 CCACCTCCCCCACTGCTGCCTGG + Intergenic
1156669292 18:39448173-39448195 CCACTGCAACCTCTGCTGCCTGG - Intergenic
1156970907 18:43154012-43154034 CCAATTCAACCACTGTTGCTTGG - Intergenic
1165145404 19:33727077-33727099 GCACTTCATCCACAGTCGCCCGG + Intronic
1166729422 19:45050346-45050368 CCACTTCACCCACACTAGGCTGG + Intronic
1166729530 19:45051053-45051075 CCACTTCACCCACACTAGGCTGG - Intronic
1168324879 19:55533289-55533311 CCACTCCACTCACTGCAGCCTGG + Intronic
925045019 2:766538-766560 CCACTCCAACCACAGGTGCCGGG - Intergenic
927276174 2:21264362-21264384 CCACACCACCCCCTTTTGCCTGG - Intergenic
928364668 2:30691813-30691835 CCACATCCCCCAGTGTGGCCTGG - Intergenic
929566161 2:42986428-42986450 CCATCTCACACACTGTTGCCAGG - Intergenic
930731704 2:54734261-54734283 TCACTGCAACCACTGTTTCCTGG - Intronic
931491612 2:62754255-62754277 CCACTCCAGACCCTGTTGCCTGG + Intronic
932607200 2:73173378-73173400 CCACTGCAACCTCTGTTTCCTGG + Intergenic
932727851 2:74194893-74194915 CCTCTTCAATCACTGTTGCTAGG + Intergenic
932777498 2:74536840-74536862 CCACCTCTCCCTCTGTTCCCTGG - Exonic
935614078 2:105058717-105058739 CCACTGCACGATCTGTTGCCTGG - Intronic
936928117 2:117758665-117758687 CCACTTCAACCTCTGTCTCCTGG - Intergenic
937577218 2:123438094-123438116 CAATTTCACCAATTGTTGCCAGG + Intergenic
938092078 2:128440779-128440801 CCACTTTGCCCACTGCTCCCTGG - Intergenic
938847563 2:135226006-135226028 CCACATCATCCTCTGTTGCTTGG - Intronic
940940033 2:159549525-159549547 CCTCTTCATCCAGTGTAGCCCGG - Intronic
941574578 2:167214400-167214422 TCACTGCAACCACTGTTTCCTGG - Intronic
942040221 2:172054090-172054112 CCATTTCACCCACTGAGCCCTGG - Intronic
944016419 2:195044747-195044769 CCCCTTGACCCACTCCTGCCAGG + Intergenic
945275530 2:207983910-207983932 CCACTTCACCCACTGTTGCCAGG + Intronic
947263572 2:228251955-228251977 CCTCTTCCCCCACTGTTGTATGG - Intergenic
1169510283 20:6256424-6256446 GCTCATCACCCACTGCTGCCAGG + Intergenic
1169636440 20:7697178-7697200 CCCCTTCACACTCTGTTTCCTGG - Intergenic
1169943880 20:10967812-10967834 CCACTTCTCCTCCTCTTGCCAGG - Intergenic
1170595733 20:17804388-17804410 CTACTTTCCCCACTGTAGCCAGG + Intergenic
1172104286 20:32506931-32506953 CCACTTCACACACTGCTGTGAGG + Intronic
1172921084 20:38482925-38482947 CCACTTCACTCACTCCAGCCTGG - Intronic
1174698174 20:52581250-52581272 TCATGTCACCCACTGTTGCTGGG - Intergenic
1174820713 20:53724535-53724557 CCACTTCAACCTCTGTCTCCTGG + Intergenic
1176846893 21:13883831-13883853 CCCCTCCCCCCACTGTTTCCAGG + Intergenic
1178498243 21:33104845-33104867 CCATTTCACCCATTATAGCCTGG + Intergenic
1179021291 21:37643396-37643418 CCACTGCACTCACTCTTACCAGG - Intronic
1181330996 22:22091086-22091108 CAAATTCACCCACTGACGCCAGG + Intergenic
1181553328 22:23653339-23653361 CCACTGCACCCACTCTGGCCAGG + Intergenic
1182125535 22:27813260-27813282 TCACTGCACCCTCTGCTGCCTGG + Intergenic
1182860741 22:33557250-33557272 CCTCTTCACCCAATTCTGCCAGG + Intronic
1183742868 22:39678309-39678331 CCTCATCCCCCAGTGTTGCCTGG + Intronic
1184818918 22:46893944-46893966 CCACTTATCACACTGTGGCCAGG - Intronic
1184836093 22:47021901-47021923 CCACCCCGCCCACTGTTGGCAGG + Intronic
1185380027 22:50504003-50504025 CCACATCCCCCCCTGGTGCCCGG + Intronic
950009028 3:9709441-9709463 CCACTGCAACCTCTGCTGCCCGG + Intronic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
951193413 3:19797086-19797108 CCACCTCACCCAGCCTTGCCTGG - Intergenic
952882846 3:37996013-37996035 CCACTTCTGCCACTGCTCCCCGG + Intronic
953381761 3:42477577-42477599 CCACTCCACCCTCTCTTCCCCGG - Intergenic
953415401 3:42712786-42712808 CTGCTTCAGCCACTGTTGCTTGG + Intronic
953432654 3:42852508-42852530 CCACATCACTCAATGTTTCCTGG - Intronic
954462009 3:50632682-50632704 CCAGAACACCCACTGTTTCCGGG - Intronic
955336080 3:58087526-58087548 CCACTGCAACCTCTGCTGCCCGG + Intronic
960817971 3:121693163-121693185 CCATTTCAACTACTCTTGCCTGG - Intronic
962461864 3:135621518-135621540 CCACTTCACCCTGGTTTGCCTGG - Intergenic
964094887 3:152919773-152919795 CTACTTCTCCCACTGATGCGGGG - Intergenic
964332691 3:155621110-155621132 CCACTCCAGACCCTGTTGCCTGG - Intronic
967307369 3:188072074-188072096 CCATTTAACCCACTGGTGCAGGG + Intergenic
967595221 3:191319841-191319863 CCAAGTCTCGCACTGTTGCCTGG - Intronic
968042288 3:195598860-195598882 TCATTTCACCCATTTTTGCCTGG + Intergenic
968704595 4:2072089-2072111 TCTCTCCTCCCACTGTTGCCTGG + Exonic
969715054 4:8864325-8864347 CCGCTGCACCCACTGGTGCTCGG + Intronic
971036253 4:22696041-22696063 CTACTTCACCAGCAGTTGCCAGG + Intergenic
975710743 4:77157834-77157856 CCCGTCCACCCACTGATGCCGGG - Intronic
976127466 4:81849195-81849217 CCACTTGACCCAGTGGTGGCGGG - Intronic
977962499 4:103102041-103102063 CTACTTCACCCAATGTGGGCAGG + Intergenic
978139161 4:105297811-105297833 CTACTTCATACCCTGTTGCCAGG - Intergenic
981042875 4:140238975-140238997 CCACTTGAGCCACTACTGCCAGG - Intergenic
981258748 4:142694296-142694318 TCACTGCAACCACTGTTTCCTGG - Intronic
988065269 5:26224136-26224158 CCACAGCACCCACTCTTCCCTGG + Intergenic
988157218 5:27471180-27471202 TCACTTCAACCTCTGCTGCCTGG + Intergenic
988821539 5:34890887-34890909 CCACTGCACCCAGGATTGCCTGG + Intronic
990746725 5:58966115-58966137 CCGCTTGACCCACTGTGGCAGGG + Intergenic
992079689 5:73223672-73223694 CCAAGTCTCTCACTGTTGCCTGG + Intergenic
992104050 5:73436111-73436133 CCACCTCCCCACCTGTTGCCCGG - Intergenic
995332192 5:110957667-110957689 CCACTCCACTCACTTTTGCCAGG + Intergenic
996663714 5:126033500-126033522 CCACTTCTCCCTCCTTTGCCTGG - Intergenic
997332825 5:133078806-133078828 TCACTGCACCCTCTGTTTCCTGG + Intronic
997522730 5:134533617-134533639 CCACTCCACCCACCGATGTCAGG + Intronic
997527791 5:134564620-134564642 CTACTTCACCTCCTGCTGCCAGG + Intronic
998387440 5:141765882-141765904 CCACTCCACCCGCTGTTTCCAGG - Intergenic
1000114528 5:158140744-158140766 CCACCTGACACACTGTTGGCTGG + Intergenic
1001519132 5:172378262-172378284 CCACTGCAACCACCCTTGCCAGG + Intronic
1002201590 5:177531682-177531704 TCCCTTCACCCACTGCCGCCTGG - Intronic
1002883782 6:1275772-1275794 CCACTTCACCAACTCTTACTGGG - Intergenic
1003915781 6:10785278-10785300 CCGCCTCACGCACTGCTGCCTGG - Intronic
1007664229 6:43505142-43505164 CCACCACACCCACTGTATCCTGG + Exonic
1010714545 6:79213198-79213220 CCACCTCACCCACTCCAGCCTGG + Intronic
1011186723 6:84684913-84684935 CCACTTCAACTAGTGTAGCCTGG + Intergenic
1011192008 6:84739124-84739146 CTACTACACCCAGTGTAGCCAGG + Intronic
1015291178 6:131539413-131539435 CCACTCCAGACCCTGTTGCCTGG - Intergenic
1017250302 6:152273141-152273163 ACACTTCACCCAATGTGGGCAGG + Intronic
1017635905 6:156442716-156442738 CCACTTCACCTGCTGTTTCTTGG + Intergenic
1017822706 6:158060779-158060801 GCACTTCACCCACTGATGGGAGG - Intronic
1023038472 7:36153107-36153129 TCTCTCCACCCACTGGTGCCAGG + Intergenic
1024864669 7:53891619-53891641 CATCTGCACCCACGGTTGCCTGG + Intergenic
1027784648 7:82565848-82565870 CCACTTCACTCACTCCAGCCTGG - Intergenic
1028760032 7:94485791-94485813 TCACTTCAGCCTCTGCTGCCTGG + Intergenic
1030162171 7:106520012-106520034 CCACTGCACCCACTCCAGCCTGG + Intergenic
1035601261 8:898241-898263 TGACTTAACCCACTGTGGCCAGG + Intergenic
1036949765 8:13130041-13130063 CCATTTCACCCACTGTACTCTGG + Intronic
1038030534 8:23634615-23634637 CCACCTCACCCACTCCAGCCTGG - Intergenic
1045910674 8:107404806-107404828 CCTCTTCAAACACTGCTGCCTGG - Intronic
1049014002 8:139906840-139906862 CCACTTGTCACACTGTGGCCAGG + Intronic
1052019027 9:23504765-23504787 GCACTCCAGCCTCTGTTGCCGGG + Intergenic
1054374946 9:64442440-64442462 CCCCATCTCCCACTGTTTCCAGG - Intergenic
1054521796 9:66080068-66080090 CCCCATCTCCCACTGTTTCCAGG + Intergenic
1056740692 9:89251847-89251869 TCTGTTCACCCACTGTTTCCTGG - Intergenic
1057250553 9:93497813-93497835 CCACTTCACCCAGCTTTTCCAGG + Intronic
1057589415 9:96359262-96359284 CCACTGCACTCACTCTAGCCTGG + Intronic
1059104754 9:111501667-111501689 CCACAGCACCCACTGTGCCCAGG - Intergenic
1060524996 9:124315445-124315467 CTCCCTCACCCACTGTGGCCGGG - Intronic
1062038607 9:134393811-134393833 CCACTTCCCTCACTGTGGCTGGG + Intronic
1062086048 9:134649062-134649084 CAACTTCACCCACCCCTGCCTGG - Intronic
1062518318 9:136946924-136946946 CCACTCCACCCACTGTCCTCTGG - Exonic
1188198789 X:27274314-27274336 GCAGTTCCACCACTGTTGCCTGG - Intergenic
1194142250 X:90220976-90220998 CCTCTTCACCCACTCCTTCCTGG - Intergenic
1196198970 X:112864070-112864092 CCTCTCTACTCACTGTTGCCAGG - Intergenic
1198111528 X:133506541-133506563 TCACTTCACACACTGTCTCCAGG - Intergenic
1198270766 X:135054010-135054032 CCACTGCACTCTCTGTCGCCTGG + Intergenic
1199074354 X:143512083-143512105 CCCCTTCACCCACTGTTTCCTGG + Intronic
1199093358 X:143715350-143715372 CCCCTTCACCCACTCTTTCCTGG + Intronic
1199214977 X:145252816-145252838 CCCCTTCACCCACTCTTTCCTGG - Intronic
1199573159 X:149288496-149288518 GCACTTCCCACCCTGTTGCCTGG - Intergenic
1199942892 X:152641830-152641852 CCACGTCACCCATTGGTGCTTGG - Intronic
1200488003 Y:3790077-3790099 CCTCTTCACCCACTCCTTCCTGG - Intergenic
1200493128 Y:3852273-3852295 CAAATTCACCCACTTTTTCCAGG - Intergenic